Gene detail

Detailed information of OS493_008164-T1 in Lophelia pertusa

Genomic Location: scaffold_19:462871...469793
NR annotation: KAJ7392924.1, hypothetical protein OS493_008164 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008164-T1

ATGAATCAGACCCCCAAGAGACACACCAAGAAGCAGACAGGGACGGCGAAAACACACCCCACTGAGAATGGCACAGGGGTGGATGGTGAACAAGAAGTTCCTTGTAATGGAGACCCTGGTGGTGCCAGCAGTGAGATGCAATCCGGCGGTGTCCCAGTGGTAAAGCATGAGCCTGAAGACAAGAATTATGAGAATTCCCTAGAAGGACTTCAAAAGATGCTTGGCTATAATATCAGCGAGGAGGTGGAGAAACAGAAGGACGAAGGCAGTAATAAGAAAAAGAAAAAGCACCTTTCTGAAAGTTCAGATGCAGATGAATTACCAAGAAGAATAGAGTGCACAGCTTGTGGAAGAAATGTGAATCCCGCTCATGGAACCATCTGCAGACACCCAGGCCTGAATGTCTTGGTCTGTAAAAAATGCAGTCAATACTACAATTCAGGACCATTTACCCGAGATGAATTTGGAGTAGAAGAACAGTGCCGGTGGTGTGGGGATGGAGGGGCACTTCTCTGCTGCGACAACTGCGAGAAGGCATTTTGTAAACTTTGTATAAAGCGCAACTTGGGGAGATCAGTACTCAAGGAGATTGTAAATGCACCAGAAGGCACAGAATGGTTATGCTTCTGTTGTAATTCCAAACCTTTATCGAAGCTTGTAAAAGCAGGCAAGCGAATTATGAACATTCTGGAAACGCGTAAAGGTCAAAAGACGCTTTTCAAAACTAAAAAGGGACCTGCTCTAGTGGTGACTCCTAGCCAAAAGGAACGACGGAACAGACTTAGTAGTATAAATGAAAATATGGGTATGAGCTCTGATGGAGCATTATCACCCTGTGAAAGTCCAACGAAAAAGACTATGCCTGAGATTAATGACAGTGATTCTCATCCTGATGATGATGATGATGATGATGATAATGATGACGACTCAGATCAGAACAGCGACAGCAAGCCAGCATCTAGAATTGCCAACAGGAAACATGGCAAGAAAAACGGTTCTACAAAAGAGGATGTTTTAGTGATTGACGATGACAGTGATGATGCTGTACAAGTTGTCAAGACATCCAAGCATAAGGGTAAAAATAAGAAGGGTCAAGCGAACAGTAGAACTAAAAGAAAACTACATGCAAGTAGTGAATCAGATGACAAAAAGAGTAAACACAAGAGTAAGAAGGGCAAGCTCAAGAAGAACAGAACAAGAAGAGATTCATCAAGTGATTCAGATTCCGACGTGGAGAATGAAAACTCAAAGTTAAGTTCAAAAGCTGCTAGAAAAAACAAAAGCAAGCATAAAGTTGTGGCTCAGAGTTCAGACGAAGATTCAGATGAACTTTCAGACTTTGTTTCTATGGTGAAACAAAAAGGCAAAGGCAAAGGCAAAAAGACTATGAGAGAGGACAAGAAGTTAAAAAAGGGCAAGGCAAAGAAGAAAGCAGTTTCAGATTCTGATGAAGAGTCTGCCGAGGAGAGTGAGGATGCAGGAAGGAAGAGACGTTCAAAGAGGGCACACATCTCGCAGAAACAAACAAGAAAACGGCCTCGTAAGATAACTTCCTCGGAAGATGAATCCAAGTCATCAGATGATAAATCGGACAGTGATGTCCCTCTTAAGAAAAGAAAGAAGAAACAGAAGCAGAACAAGAAAAAGCAAAGGGTGGCGTTGGAAGATGATGATGATGATGATGACTCTGAAGAAGAGATTGTCAGGAAAAAGAAAGGCAAATCAAGACGGAAAACTAAAAAGAGCAGCTCTGAATCTGAAGATGACAACAAGAGGAAGAAGAAACGAAAGGCAAAAGGCAAGCAGAAGAAAGGACGGAAGAAACATTACATTGAGAAAGATAGTGATGACTCAGAAAAAGATGAGGAGGAGGATGAGGAGGATGAGGAGGAAGTTAGCCCATCAAAACGGAAAGGCCGTAAGAAAATCCGCAAACTTATTGAAGATGGAAAGCTTGCAGAAGAAACCCGAAAAGCAAGGAGACTTGAGGAGGAGAGGCGGAAACGCCTCCTGGAAAGGACTCGTAACAATGAACTAGATGACATGCCTAGTGAGTCTGCTAAAGTGGCCAGACTTGTGCTTGAGGCCGACTCGAGTACAAAGGAGCCCATTGTGGAAGTGAAGGAAGACCTTCTGCAGCATTTCAAGCCACATCAGTCTAAAGGAATCCAGTTCATGTATGATTGTCTAATTGAGTCGGTTAAGTCATGGAAGAAAGAGGAGCCTGGATCAGGATGTCTACTGGCACATTGCATGGGACTTGGCAAGACATTACAGGTTGTCGCTCTTGTTCATACCCTCATGAAGCATGAAGATATCAACTTGCAGCGGGTGCTAGTTGTAGCTCCACTCAACACTGTCTTAAACTGGCAAGTCGAGTTTGAAAAGTGGCTTGGTGTGGATGACAGACTTGAGGTTTATATCCTCCAGGAGGTGGGCGGTAACAACTGGCGCAGAGCAGACATGCTCAAACACTGGCTGCGATACGGCGGTGTAATGATTACAGGCTATTCACTCTACCGTAATCTGGCACACTGTTACCGGATCAGAAGCAAACACCAGAAGAAAATATTCCAGGAGGCTCTTGTTGATCCAGGTCCTGATATAGTGGTTTGTGATGAAGGCCATATCCTGCGCAATGATGCCAGTGCTATCTCTAAAGCACTCAATGGTATCAAGACAAAAAGACGCATTGTGTTGACTGGAACTCCTCTACAGAACAATCTTATTGAATATCATTGTATGGTGAGTTTTTGTGAAGCCAAATCTCCTTGGTACACGGAAAGAGTTCACCAACTCGTTTGTGAATCCCATCCAGAATGGACAGTGTGCAGACTCCACTGTGCTTGA

Transcript

OS493_008164-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P46100	Transcriptional regulator ATRX OS=Homo sapiens OX=9606 GN=ATRX PE=1 SV=6
Q7YQM4	Transcriptional regulator ATRX OS=Pan troglodytes OX=9598 GN=ATRX PE=2 SV=1
Q7YQM3	Transcriptional regulator ATRX OS=Pongo pygmaeus OX=9600 GN=ATRX PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001641 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17981 all species →	ADD_ATRX	Cysteine Rich ADD domain	Domain	Interproscan
PF00176 all species →	SNF2-rel_dom	SNF2-related domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR044574 all species →	Family	ATPase ARIP4-like	Interproscan
IPR041430 all species →	Domain	ATRX, ADD domain	Interproscan
IPR038718 all species →	Homologous_superfamily	SNF2-like, N-terminal domain superfamily	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR025766 all species →	Domain	ADD domain	Interproscan
IPR000330 all species →	Domain	SNF2, N-terminal	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45797 all species →	RAD54-LIKE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0140658 all species →	Molecular Function	ATP-dependent chromatin remodeler activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10779	ATRX; transcriptional regulator ATRX	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008164-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

45.4Max TPM

5.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.30	7.74
polyp at pH7 6	18	18	5.47	8.28
coral polyp · control treatment	16	16	10.21	45.41
coral polyp · oil and dispersant treatment	16	16	6.93	34.23
coral polyp · oil treatment	16	16	6.00	10.43
coral polyp · dispersant treatment	16	16	4.64	11.66
Polyp	10	9	1.43	2.96

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.74
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.38
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.18
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.51
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.17
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.07
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.91
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.51
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.04
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.60
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.35
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.34
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.18
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.28
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.94
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.66
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.71
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.56
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.05
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.65
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.36
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.87
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.63
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.29
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.08
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.57
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.03
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.27
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.63
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.62
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.57
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.28
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.84
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.39
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.77
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.34
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.23
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.37
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.66
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.52
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.24
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.54
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.20
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.16
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.34
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.18
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.81
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.25
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.64
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.60
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.43
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.12
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.26
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.53
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.98
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.84
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.28
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.79
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.81
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.34
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.66
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.21
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.53
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.53
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.22
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.16
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.96
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.73
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.09
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.96
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.56
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.20
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.04
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.01
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.97
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.52
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.