Gene detail

Detailed information of OS493_008183-T1 in Lophelia pertusa

Genomic Location: scaffold_19:739381...787254
NR annotation: KAJ7392942.1, Phosphoacetylglucosamine Mutase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008183-T1

ATGGCTGGGAGAATTCCATCAGAAGATGTGCGTCAAACATCACAAGGATTCCGTGGACCATTTTCAGAGCCAAGGTCGCATAGGCGACCACCACGCCAATATCCTGCTAGTATGGATACTGATTTAAGCCTAGTTGCTGAGTTACGCAGGTCCGAAGAGCAGGCTGCAGCTGGACAAAGATCTTTGCCTAATAACCTGGGATGGTCATCAAGAGCTAGTGCTCAGTCACCATCAAGTAGTGCAACAAAGAAGAAAGGAAAGCACTTTGAACAAGTGAAGCTACCAGCAAAGACCAGCTCAGATTTGCCGGTTCCCCATTCCGATAGTGCTCGTTTCACCAGGAAACGTCACCATACACCTGCTACTCTGCCAAGAACACGCCTACCAGCTAGTACACCTGTGGCTGAAAGGCAAGCATTGGAAAGTTTAAGGCAAAAGTTGGCTTTTGGGGATACAGCTGAGCCTATTGAACAGAGCCCCAGAAGTAGAGCTGCAAGAACATCACAAAATCCATCCTCTAGTACGGCAAACAATGAGAGAGATCTACCAACACAGCCAAGAGCCCTAGCATCTGCTAGTTTACCAGTATTGGAGATGAATGAAACTGAGGCAACAAGAGCTTCCTCAGAGGGTGCCTTTACTTCAGCAATCTCCAAGGTCAACACACCATTGATAATTGCAAGACTAAACCAAGTTCGGGACTTTCTCAAACAAGCAACAACTATGTTTGTTACACTGCAAACTACTAGTATCAATGAGCAGCGGGCTGTGGAACATGATTCAACATTGGACAACACACCTTCCTTGAGTCTACAGTCTTTGACAGAAGATGAGAAGAGCGAGTCAGCATCTATTAGAGATGAAGAACTCCAAGGACTGCGACAACAGCATGCATTATTGAAGAAGATGCTAGAGCAGCAACAACAGCTAAAGGAGCTACAGACCAGGCAAGCTGCTCTGTTAACCTTGCAGCGTGATGCAGAAATACGTTTGGCTGAAGCTGAGGAAGAGGAAGAGTACGCATTGAAATCAAAATGGCGGATAAATCGGCAACATGTCTCAGAGGAAGATGAGGCAGTTGGAGGTGAGGATGGTGAACCTGGCCGGAGTAGAGGTGCAACAGAAACTTCTCAAGCATCATATCTCGATACAGCACCCGAGAGACCCAGTGCAAGTGTCTTGGATGATAGTCGGTTTACACCTCAAGAGCTGGAGCTTATGAACCTCCTCAGAATGCACAAAGAGAAGTGGAGGGCTGCTGATTCTGGAGACGAAAAAGATACAGATGAAAGAGAGAGCCAAAGGACAAAGAGAACAAACCAGCCCCTGCCGGCAACAACAGCTCAAGTACTGGTCGTAAATCCTGAGCCAAGTGAAGAAGTTGCTGATAATGAGGAGGCAGCCATAGCTCTTGCCAATGCCACACAAGAACGGTTGGAGCTTGAGAATAAGCTGATGGTTTTAGAGGCAAAGAAAGAGCAGATGGACACCTTGTTAAGCGAGTTGCGGTCACTTAAAGAAGCACAACTGAGAAAAGAAACCTTAGAAGCTGGTGGTGGGACAAGTTCAAGTGTTAATGAGTCTAAACAAGAGGAGGATGAACCCCTGGCCACCACATCACAAAAACTAGATGACGAACGTATCTTAGAGGCTCTAGAGGTCCATGAAAAACTCAAAAAGCTACAAGAAGTGAGAGATCGGTTGAATCAGTTGCGAGACTTGATTGGTCATTATCAGCCTTCACTGGATGAGTCAGATAGACCAGAAACTGTAGCACAAACCCACCCTGGGCTTGAACAACTTAGTGTTCCTATCCAAAGTAGTGATGAACCCGAGGAACCTGAAAGTGCTGCTGGAGGAGCTAGTGGTGGTACAGACCAGGACTTCAACAGTATTGAATGGATGTTAAGTGCTGGCATTGAAGATCCTGACCTGATGGGGAAAATAAGGCAACTTCAGGAAGCAAGGGCAAGGGTTGCTCATCTTTTTAAACAGACAAATGAAAGTACCCAGATGCCTCCATCCAGAGTGAACAATGAAGCTGTACAAACACAGACAACAGAGGAAGAATCTGAAGCAGACACACAGACAGACACTGATGCCGAGAGTGCAGTCAGTGCTGGAAGTTCAAGTGTGAACGCTCTGGCATGGCAGGATGATCCTGAATTTCAGGCCAAAGTCCGGAAGCTCCATTCTGCAAAGCAGAAACTGAAACAGCTTCAAGAACTTGTCAAGAAGATACAGCAGTTTCCAGAATCAGCACCGACTTTACCAGCAGAATTGGCAGAACTGAGCTTTGATGAAGAAGATTTTGATGACGAAGATGATGATGATGATGATGATGAGGAGGAGGAGGAGGAGGAGGAGGATGAGGAGGGGGAGGGGGAAGAAGAAGATGAGGACGAGGAGGAAAGAGAGGAAAGCAACAGATCAGAGACTTCAGATGACAACGAGGGAGGGCATGTGCAGAATGAGGACGAAGGAGTCACTACAGGTACAGAGGATGAAGACGCAGGTGGAGACACTGCCGCTGCTGCTTTGAACAGGAACAGACTGCTGGATCTTGAGGGGAGTGACCAAGAAGCAGTATATCAAAGGTACCTGCAGAAGCAGACCGCAGAGCTTGAGCAGCTACAACAGGAAAGACAAAGATTACTGGAAGTACAAGAGGAACTGGCAAGAATGAGCCAACGGTCTGAAGTTCACAAGACAGTTGCAACACAGACATTTCAAGCTACACGAGCACAGCCACAAAAGCCTGAGTCAGCAGGATTAACACTCAGGAATGGTACTTTCACCATTGGCAGATCAGGTCCTGACTCAAAGAGACCAGTCATCCATCAGCCTGTTAATAGAGAAATCTCCACTCAGACACCATTTTATGGGTGTGATCTGAGGGCTGCAAGATCTGAAGAGTCCAATGAACCCCCAAGAGCTCGTCCAAGTGCATTGGTATGGTCAGAACTGAGACGTCAGAGGGAGCTACACGAGGAGAAACTGAAGAAAAGAAAGCAGAAGTTTTTAGAGAAACGAAAGAAGGCAGGCCTGGACGATGTGTCTGAAGGCGGGACGTACTCTGTGAGGAGTTGTAGAAGTGGCGACATAGATGAAGGGTTCGGCGTGAGTATGATGAGTGCTGATATCACTACAGCTACATGGGGTGGCTCCACTCAACCCAGTAGTACACAGAATGATTCAGCAGTGTCAGCTGATGAGTCTGATGAGGAGAACCAAGATGCAGAGATCGCAGTGGAAGTAGAAGATGATTATCCTGATGGTATAGTTCAAGCAGAAGAGGAAGAAGAAGAGCGTCTTGAACCAGAAGATTTCTCTGGAGGAGCTCAGGCTGTGTTCAGGAGCAGAGAAAGAGTGCCTCGTATGACCACCTTCCGAGGGAGTGTAGAAAGCAACTCGCAGACACGTAGCGGCAAGAAACGCAAGCTTGATGGTAGCGCTATGTCAGGTGGGACCCGAAAAAGGGAAAGAGAGAGAGGACTTACATTTGAAGACTGGCCCAGAACATTCTACTTTGATAGGAATTCCAGAGGAAGAATCAGGCAGGAAAACTTTACTCCTGCTGAGCAACTCATTAAGGAACGAGAACAGGAACAATTCAACATGGAGCGCCAAGCGTGGGAACAGCACTGTGAGCGGCTCCACCAAGAAGTGTCCTCTCTCACCTCCCTGTGCAATGGACTCCTCAGGGATCAACAAGTGCTGGTATCTACAGTGATTGGTAGAAATGTCCCCAGCGGGCTTGCCTCAAGTCCCGGTTTTCCTAACATTCCTGGCCCGGTGCCAGGTCTTGTATCAACAGAGGCAGCAAGAAGCCTTCCAAGGACTGCAAGGCTCTTTGATCAACAGCGCTACATGCAGCAGCAGCATCAGATACTACAAAGCCTCAATCAGTGCTATTCACAGCTTCAACAGCAACACCAAGACATGGCGTCCCTTCAGCAACAATTCCAGCAGCTGTTTACTTACAATCCATCTTCCGCTTACAGTGATAACAATCCCTCACCACAGAGACCCCAAACTGTGTCTCCTAACATTACCAATGCCTCTCCATCGTTCATGAGTCTGCCTTCGCATAGTATATTTCAGCCACCATTCTCAGCACCGTTGATGAGCCAGGCTCCTTTCACGGGTGAATATCAACCGTCTCCATCAGCCCCTGTGTTCAGAAGTACTTGGCATCCACCTTTTGGCCAGCCAGAGGTATCTAATGAGCCTCCACAGACAAATGAAGAAGCGTCTGGCAGCAGAGCAAAGCCAATACAGGAATCTTTCAATGTAAACCCTGACACAGGCATCCCAAGTCCAAGACAGGAACGCAAATATGATCCTAGTTCATACCAAGAACTGGCATCTACAAGTGCAAATGCATCTAAAACAGACAGCCGTCCAGATGTGATCGGTCGAACGTTCAACACACCTCTGAGGGCGTCAGCTGTAGCCAGCCTTGCACAGAAGGATAAATCAACTCAGAAGAGCACAGGGTTTAGTTTAGCACAGAAGCGCGCAGCTGAATCAGTATCTTCAAGAGCGTCCAGTGTGCCAGGAGATGTACAGGATGTGGCAAGAGGCGCTTGGCAAGATGCAGATAGGGCCTCTGAAGCTGGAAGTGAGTTTTCGCTTTTTGAGGCACTCAGAGATTCCATTTATTCCGAGGTTGCAACCCTCATTTCTTTGAATGAGTCCCGACCACATTTTCTGCTTGAATTGTTCAGGGAACTGCAGCTGCTGACATCAGACTACTTGCGGCAGCGCGCTCTGTACGCCTTACAGGATCTGGTGACGAGGTTCTTAACGGAGGATTCCGTGGGTGCAGATGGAGGGCCTCTACATCAGGCACGATTCCAGGAATGGTTGGGATCTAATTCGGAACTGACTCCCAGTGAAACAGTAGAGACTTTTGAAGACGACGAATCAGAGACTAGAGAGAATGCCGTCCCCGCCGAAACTGTGACAGAGGGAATATATGACTACATGGAGCATGTGGAGTCTGGTAGCACCCTGTCCACCCCTACATCCAGTCACACAGGAGAGGCACCATTCGCCTCTGAGGGCCTGGGAGATACTGTCATACACCTCGACAAGGCTCTGAGCAGAATGCGCGAGTATGAAAGACTGAGAACTGAAGGGAAACTGAGTGAATTAGTGACCGGTCCACCCGTGCTAAAAGACAAGCTTGTCAAAGATGACGTCACCACAAGCTCGGCTGGTGACGTAGGAAGCGAATCCTCCATATCAGATGTGCAGTACCCAAGGATTGACACTCAAGCCCTGGACCACCTAATCAAGTCTATTATGTCGGAAGTAATTCCTTATCTGAATGAGCACATGGAGGATAACTGCACCTCTGAGCTGCTTGGTTACATTAGAAGCCTTGTGTTATCACGGATTCAAGTCAATGAAGATCAGGAATTTGGAAGATTCTTTCATAAACAGCTGGCTTCCATTCTCCAGGACTCACTCTCTAGATTTACAGACAGAAAAATGAAGGACTGTGGCGAGGATATGCTGGTGGACATGTCTGAGATTCTGTTCAACGAGTTAGCGTTTTTTAGACTCATGCAGGACCTTGACGGAGGTCGTGGAGCAAGTCAGAGACCAACATGGCGACAGGGATTTGACTCTGCCAGCACAGACACTGGGACAGGTCAAGATGGCGATAAAGAGGACGGGGATGAGACGGAGGAAAAAGACGAGAATCCGCCTGAAGACAGTGCTGTAGAGGAAGAAGGCGTCGGGGCTGCTGATGAACGAGAAGAGGCTGAAGGCGAAGAGGAGGAGGACGACGACGAAGAAGAAGAAGTGAGTAGCGAGGAGTCTTCTTCATCGGAGGAGTCTGGAGCTGAAGACGAAGGGGCAGATGACGAAGGACCAGAAGATGAAGAAGAAGAAGAGGAGGAGGAGGAGGGTGCGGCTGCCACGGCAATCACCAAAGAGCAACAAGAAGCTGAGGAAGAAAATCTGGGAAAGACAAGAGATGATGTAATGGCTAGTCAATTTGAGGACAGGCCATCAAGTTTACCAGAGAATAGCATTCTGGATTTCCCACAGAATTGTGTCAAGTTGGAACTGTCGGCCAGTGAATCAAAGCCTTTTTCAAGTTTTGGAAGTGGAGAAGAAGACGGAGAGGAATCATTTGACGACTCTGATGCCAGGCGGAAGCTGGAAGAATACCAAGGAAGCACAGCGGCGGCAGCCTCAGCTGATAGAGACCGAGGAAACAACAGAGACGGGCCTAGTGACAGCGATGATAACGGTGCACCCCAGGATGAACAGCGCCAGGCTGTGGAGGCTGCGGCTGAAGCAGCTGCTGCAGCTGGAATATCCTCGTATTTACAAAACGGACAGATCGCTAACGGTCAAGATGACAGTGAAGTCATCCTAGATGACCTTCCTACCAAACTTACTGGATTGACCGAGGCGGACCTACAGGCTCGAATCGCAGAAGAACAAAGCCGGAGTGAAGGATCCTCGGGTGTTCTCGCACATCTAGATGGATTGCCAGAACTTGCGGGTGATCCCGAGGCCCTTCACGAGCCAGGTAACATCATTAGAGAAATATTGCCTTTTCGGCGGATCTCCCCAATCAAAAAATAG

Transcript

OS493_008183-T1

Protein

OS493_008183-T1

MAGRIPSEDVRQTSQGFRGPFSEPRSHRRPPRQYPASMDTDLSLVAELRRSEEQAAAGQRSLPNNLGWSSRASAQSPSSSATKKKGKHFEQVKLPAKTSSDLPVPHSDSARFTRKRHHTPATLPRTRLPASTPVAERQALESLRQKLAFGDTAEPIEQSPRSRAARTSQNPSSSTANNERDLPTQPRALASASLPVLEMNETEATRASSEGAFTSAISKVNTPLIIARLNQVRDFLKQATTMFVTLQTTSINEQRAVEHDSTLDNTPSLSLQSLTEDEKSESASIRDEELQGLRQQHALLKKMLEQQQQLKELQTRQAALLTLQRDAEIRLAEAEEEEEYALKSKWRINRQHVSEEDEAVGGEDGEPGRSRGATETSQASYLDTAPERPSASVLDDSRFTPQELELMNLLRMHKEKWRAADSGDEKDTDERESQRTKRTNQPLPATTAQVLVVNPEPSEEVADNEEAAIALANATQERLELENKLMVLEAKKEQMDTLLSELRSLKEAQLRKETLEAGGGTSSSVNESKQEEDEPLATTSQKLDDERILEALEVHEKLKKLQEVRDRLNQLRDLIGHYQPSLDESDRPETVAQTHPGLEQLSVPIQSSDEPEEPESAAGGASGGTDQDFNSIEWMLSAGIEDPDLMGKIRQLQEARARVAHLFKQTNESTQMPPSRVNNEAVQTQTTEEESEADTQTDTDAESAVSAGSSSVNALAWQDDPEFQAKVRKLHSAKQKLKQLQELVKKIQQFPESAPTLPAELAELSFDEEDFDDEDDDDDDDEEEEEEEEDEEGEGEEEDEDEEEREESNRSETSDDNEGGHVQNEDEGVTTGTEDEDAGGDTAAAALNRNRLLDLEGSDQEAVYQRYLQKQTAELEQLQQERQRLLEVQEELARMSQRSEVHKTVATQTFQATRAQPQKPESAGLTLRNGTFTIGRSGPDSKRPVIHQPVNREISTQTPFYGCDLRAARSEESNEPPRARPSALVWSELRRQRELHEEKLKKRKQKFLEKRKKAGLDDVSEGGTYSVRSCRSGDIDEGFGVSMMSADITTATWGGSTQPSSTQNDSAVSADESDEENQDAEIAVEVEDDYPDGIVQAEEEEEERLEPEDFSGGAQAVFRSRERVPRMTTFRGSVESNSQTRSGKKRKLDGSAMSGGTRKRERERGLTFEDWPRTFYFDRNSRGRIRQENFTPAEQLIKEREQEQFNMERQAWEQHCERLHQEVSSLTSLCNGLLRDQQVLVSTVIGRNVPSGLASSPGFPNIPGPVPGLVSTEAARSLPRTARLFDQQRYMQQQHQILQSLNQCYSQLQQQHQDMASLQQQFQQLFTYNPSSAYSDNNPSPQRPQTVSPNITNASPSFMSLPSHSIFQPPFSAPLMSQAPFTGEYQPSPSAPVFRSTWHPPFGQPEVSNEPPQTNEEASGSRAKPIQESFNVNPDTGIPSPRQERKYDPSSYQELASTSANASKTDSRPDVIGRTFNTPLRASAVASLAQKDKSTQKSTGFSLAQKRAAESVSSRASSVPGDVQDVARGAWQDADRASEAGSEFSLFEALRDSIYSEVATLISLNESRPHFLLELFRELQLLTSDYLRQRALYALQDLVTRFLTEDSVGADGGPLHQARFQEWLGSNSELTPSETVETFEDDESETRENAVPAETVTEGIYDYMEHVESGSTLSTPTSSHTGEAPFASEGLGDTVIHLDKALSRMREYERLRTEGKLSELVTGPPVLKDKLVKDDVTTSSAGDVGSESSISDVQYPRIDTQALDHLIKSIMSEVIPYLNEHMEDNCTSELLGYIRSLVLSRIQVNEDQEFGRFFHKQLASILQDSLSRFTDRKMKDCGEDMLVDMSEILFNELAFFRLMQDLDGGRGASQRPTWRQGFDSASTDTGTGQDGDKEDGDETEEKDENPPEDSAVEEEGVGAADEREEAEGEEEEDDDEEEEVSSEESSSSEESGAEDEGADDEGPEDEEEEEEEEEGAAATAITKEQQEAEEENLGKTRDDVMASQFEDRPSSLPENSILDFPQNCVKLELSASESKPFSSFGSGEEDGEESFDDSDARRKLEEYQGSTAAAASADRDRGNNRDGPSDSDDNGAPQDEQRQAVEAAAEAAAAAGISSYLQNGQIANGQDDSEVILDDLPTKLTGLTEADLQARIAEEQSRSEGSSGVLAHLDGLPELAGDPEALHEPGNIIREILPFRRISPIKK

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8AV28	Pericentriolar material 1 protein OS=Gallus gallus OX=9031 GN=PCM1 PE=2 SV=1
Q9R0L6	Pericentriolar material 1 protein OS=Mus musculus OX=10090 GN=Pcm1 PE=1 SV=2
Q15154	Pericentriolar material 1 protein OS=Homo sapiens OX=9606 GN=PCM1 PE=1 SV=6

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002247 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15717 all species →	PCM1_C	Pericentriolar material 1 C terminus	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031446 all species →	Domain	Pericentriolar material 1 protein, C-terminal	Interproscan
IPR024138 all species →	Family	Pericentriolar material 1 protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14164 all species →	PERICENTRIOLAR MATERIAL 1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0007098 all species →	Biological Process	centrosome cycle	Interproscan
GO:0034451 all species →	Cellular Component	centriolar satellite	Interproscan
GO:0034454 all species →	Biological Process	microtubule anchoring at centrosome	Interproscan
GO:0035735 all species →	Biological Process	intraciliary transport involved in cilium assembly	Interproscan
GO:0036064 all species →	Cellular Component	ciliary basal body	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0071539 all species →	Biological Process	protein localization to centrosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16537	PCM1; pericentriolar material 1 protein	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008183-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

89.1Max TPM

19.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.57	31.29
polyp at pH7 6	18	18	16.68	26.22
coral polyp · control treatment	16	16	26.45	89.11
coral polyp · oil and dispersant treatment	16	16	21.82	75.27
coral polyp · oil treatment	16	16	20.92	34.82
coral polyp · dispersant treatment	16	16	18.27	28.54
Polyp	10	10	7.70	15.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.29
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.95
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.09
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.61
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.82
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.73
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.55
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.73
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.93
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.54
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.23
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.32
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.31
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.92
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.90
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.22
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.14
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.90
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.39
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.67
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.51
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.18
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.08
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.01
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.37
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.43
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.31
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.41
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.65
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.08
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.94
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.10
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.74
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.50
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.17
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.09
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.89
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.49
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.14
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.42
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.27
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.49
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.38
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.35
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.16
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.78
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.83
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.62
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.85
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.71
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.34
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.80
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.82
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.66
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.03
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.24
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.08
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.58
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.93
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.95
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.42
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.24
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.76
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.07
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.48
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.24
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.44
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.93
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.54
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.11
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.75
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.78
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.56
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.70
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.95
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.25
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.55
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.07
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.09
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.75
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.40
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.38
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.56
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.20

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.