Gene detail

Detailed information of OS493_008229-T1 in Lophelia pertusa

Genomic Location: scaffold_19:1454819...1481842
NR annotation: KAJ7392984.1, Serine/threonine-protein kinase plk4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008229-T1

ATGACTTCTCGTTTCATGGGAGACTCGATTGAGGACTTTCAAGTCCTGGAGCTGCTTGGCAAGGGAGGCTTTGCTTGTGTGTACCGTGCCTGTTGCATAGCCACAGGACAGGAAGTTGCTATCAAGATGATTGACAAGAAGGCCATGAAAACATCAGGCATGGTGACAAGAGTCATAAATGAAGTGGAAATTCATTGTCAACTGAAACATCCTACTATACTTGAGCTCTATAACTATTTTGAAGATGCAAATTATGTCTACCTGATCTTGGAAATGTGCCACAATGGAGAAATCAACCGCTACCTCAAGAAAACAGGGAGACCAGTTGGTGAAAATGAGGCTCGTCACATTATGACTCAAGTTGTCAAAGGAGTTTTGTATCTTCATTCTCATGGCATCCTTCATCGGGATCTTACATTAGGAAACATTCTTCTCACCAGAGGAATGGATGCAAAAATTGCTGATTTTGGTCTTGCAGCAAGACTAACGATGCCTAACGAGAAACACTACACAATGTGTGGAACACCAAATTACATTTCTCCTGAGATAGCCACCAGAGGACCTCATGGTCTTGAGTCTGATGTCTGGTCACTGGGATGTATGCTTTATACTCTGCTTGTTGGGAGTCCTCCTTTTGACACTGAGGCTGTTAAGAGCACGTTGAACAGAGTAGTATTGGCTGATTATAATTTGCCATGTGATATGTCATCACCGGCCAAGGATCTCATCAGTCAGTTATTGAAGAAGTCCCAGTGGCTTTATACCTGTAGCTCACTTGGCATCTGTGCAGTTGCACTGGCATTGCAAGAGTCATGGCGCATGAATCCAGGAGACAGGATCACATTGTCAGGGATTTTAGATCATCCATTTATGACTCAAGAAAGTATGTTGAAGTATTCATCAAACCATCAGCTTTATCCTCCGCAGCATGTTGTGGAGCAGTCGTTAGACAGTGGGACAGGTACAATGGCTACAGTATCTACAGGCTTTGGTCGAACCTCAAAATCCACCCGTAACAGCAGTGAGCATACAAAATCCATAGGAGTACAGGGAAACCCTAATAATGACGCCTTCACTGACAGATCAAGTGACCGTCAGTCAGACATGTGGCCAAGACACGGCAGACACCCACCTTCTCCACCAGTTAGACAGAGAGCAAGTCACAGTACTAGCACAACTGATCAGAAAACAAGTTCGGCAAAAGACCTGATACGTGGAACAGAAGTGGCCCCTCCTCCATCCTCAGGCTACAAACCAACTGCAAACTCAGCATCCTGGCTGTCCAACATCACTACCTCAACCTTCAGAAACAAACAACCAAAAGCCTTGGAAACGACCAATGGTGAAAACAATCTGGTCACAAAATTCAAGAATTACAATGCCAGCAAATACAGCAGCTCATGTGGAAACACACTTGGAGACTTTCTCAAGAACACAACCAATGGGACAAATACAAGCAGCAGTGGGTTCAGTAGTACAGAAACAAACCTGTGCCGTCAAGGAAAGGATCAACAACCCGCAGCCTCTGATCTCAACAGTCGTAGCTTTACCAAGCAGACATCTGCTGATGTAAACAGCTCTGGTTGCAAAGAGACAGCAGCAGGGTGGGGAGATCATCGGCAACATCGTCGACGTGGCAGCAACAGTGTCACGAAAGATTCTGGGTTAGACTTTTCCCATGTGCAGGAGGATCCCGCTAGTGGCATGCCTGTAACACAAGGAGGTGGTGAACAGCGAAAGAAAAACCAAAGAAACAAATCAGACATGTCAAGATCTAAGTCCCTTGGAGACATTGTAGAACCTTTGAATTCTGAGAGGCTCAGGCCCATTCGACAGAAGACCAGAACTGCGGTCATCAGCATCATTGATGATGGTGAAGTGTGTCTGGAGTTTTTTCATCATAAGAATGGCGAAGACAGAGTTTTTGAGGTGCTGCGAATATCCCAGAATGGGATGAAGATATCCGTGTACCAGCCCAATGGGAAGTCAGGTGTTCCTCTGTCATTGCAACCCCCTTCTCCTCCTCCCGGTGGGTGTGAGTCAACACGTACATACCTGTTCTCCAACTTGCCGTCAAAGTACTGGAAAAAATACCAATATACCACTAGATTTGTTCATCTTGTGCGCAAGAAGACACCAAAGGTGACCATGTATTCCAAACATGCAAGATGTATGCTGATGGAAAATACTCCACATGCAGATTTTGAAGTCTGCTTTTATAATGGGGCCAAAGTTCACCAGTCGCAGGAGTGTACACGGATCATAGAGCCTGGAGGTGTGTCGTACACGCTGGAGTCAGTGGGTGGCCTGGAAGAGAGAGTTATCAGGAAAGAAGAGTCCAACAGTAATGGAGGGCAGTACTTTCCATTTACCATGTGCCGTAAACCACCAGTGTCGAGAAAGCTGCCAAAGGGAGGTGATGTTCAGACTGAAGCACACAATTCTAGGCCTCTTGACTCTATCGAAAATCTAACTGCAACATCCCCTAGCACCTTAGCCCCAGTCAGTACATCTTTGATGTCGTTTGATGGCACTATTGTGACCACCTTCCAACATGCACGACCATCTTCTGCTGGGCATGATCGAAATGTTAACAGAAGATCAGCTTCCTGTGGTGATGAGTCTGAGACCACTTCCACATCACAGTGCAGACAAGAGAGAAGAAACCAGCAGAGTCAGCTGACAGCCAAGGGTGTGTCTAGACAGGGTTCAACTGTGTCGCCATCGTCACAAGTTATCAAGAGTGTGTTTGTGCAAGGAGTAGGTTGGGCATCTCAGTTGTCCACTGGAGAGGTGTGGGTTCAGTACAATGATGGATCTCAGATGGTCATTCAATCCTCTGTAACAAGTATCAAATATACAGATAGTCAAGGAACAATAACAAGATACAGTCATTCTGACAGATTGCCGGAACCAATCAAGGACAAGCTGTCTCGCCTCCCAGTCATCATAGAAAATCTAGCTTCTTCACCCAAGATGTTATAG

Transcript

OS493_008229-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7SNN5	Serine/threonine-protein kinase PLK4 OS=Nematostella vectensis OX=45351 GN=v1g246408 PE=3 SV=1
Q6PAD2	Serine/threonine-protein kinase PLK4 OS=Xenopus laevis OX=8355 GN=plk4 PE=2 SV=1
B3DL84	Serine/threonine-protein kinase PLK4 OS=Xenopus tropicalis OX=8364 GN=plk4 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005533 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan
PF18190 all species →	Plk4_PB1	Polo-like Kinase 4 Polo Box 1	Domain	Interproscan
PF18409 all species →	Plk4_PB2	Polo-like Kinase 4 Polo Box 2	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR046437 all species →	Homologous_superfamily	Serine/threonine-protein kinase, first cryptic polo-box domain superfamily	Interproscan
IPR000959 all species →	Domain	POLO box domain	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR033699 all species →	Domain	Plk4, first cryptic polo-box domain	Interproscan
IPR033698 all species →	Domain	Plk4, second cryptic polo-box domain	Interproscan
IPR047108 all species →	Homologous_superfamily	Plk4-like, second cryptic polo-box domain superfamily	Interproscan
IPR033696 all species →	Domain	Plk4, C-terminal polo-box domain	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24345 all species →	SERINE/THREONINE-PROTEIN KINASE PLK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0000776 all species →	Cellular Component	kinetochore	Interproscan
GO:0000922 all species →	Cellular Component	spindle pole	Interproscan
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0007052 all species →	Biological Process	mitotic spindle organization	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08863	PLK4; polo-like kinase 4	EC:2.7.11.21	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008229-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

22.2Max TPM

5.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.14	8.70
polyp at pH7 6	18	18	5.92	7.92
coral polyp · control treatment	16	16	6.57	22.24
coral polyp · oil and dispersant treatment	16	16	5.72	20.61
coral polyp · oil treatment	16	16	5.51	9.99
coral polyp · dispersant treatment	16	16	5.42	9.61
Polyp	10	10	4.93	9.31

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.70
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.45
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.97
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.95
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.71
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.54
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.48
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.28
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.37
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.19
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.93
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.54
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.09
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.72
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.92
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.18
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.08
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.06
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.36
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.11
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.84
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.40
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.39
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.12
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.06
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.51
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.36
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.24
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.83
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.07
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.81
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.35
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.27
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.20
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.15
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.98
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.09
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.31
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.07
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.61
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.75
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.80
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.98
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.90
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.54
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.60
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.41
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.00
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.37
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.93
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.86
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.74
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.68
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.56
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.90
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.97
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.62
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.61
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.55
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.07
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.17
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.01
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.95
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.80
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.13
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.28
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.99
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.52
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.33
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.83
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.72
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.99
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.58
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.81
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.37
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.10
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.23

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.