Gene detail

Detailed information of OS493_008242-T1 in Lophelia pertusa

Genomic Location: scaffold_19:1738358...1753904
NR annotation: KAJ7392995.1, hypothetical protein OS493_008242 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008242-T1

ATGTATGTTGGCCGTCATCATGATTACGAAAGATATGAAGAAGAATCTTCCGAAGAAGAATGCGAGCAGTGCTCGAGACAGGACATTCATTTGCGGGAGGAAGACGACGACTTTTGGTCGAGAACACTATACGAAGAGCCTCCTTGGGCCGGTCATATTAAAGAGAAAGGCGATGTATTTTACATCGAACCGTTTAACGAACCGTCTCCAAACGACATGTTGGACTCACTGGAACAATTAAACGTTTCTGGGAAAGATTCTCAAGGCGATGGAGTGAAAGAGAAGGGAAAACCGGTTCTTCGAAGTTTTAACTCGGTGAAGAAAATTATTCCTGGTTTGAGGAAAGACAGAATCGACGACAAAAGCAATAATGAGAGAAACTTAAAACATTCAAGCTCTACAGGTCATGGAGCTGTGGATGGGCTCATCGATGGTAGCAAAATGGCTGGTAGATTTTTCAAGAGAGAGGTGCAGCTTATTGTCACCCCTCCAAAGGGCCATTCAGGGTTCAAAAATGACTTGGAGACCTTGCTTGGTATTATTCCCGGAAGGGACAAAGCCGGCAAGTTGTCGCAGAATGACAGCTACTCTGGATCAAGGTTGTACATCAAAGGATTTGTTCCCGACGGACCTGCTTTGCGAAGTGGAGATCTAAGAATAGGAGATGTCCTTCTTTCATTAAACAAACTGGATCTTAATTCTAGCAATGTTCACACAATACTTGCTGCCATCACTGGCCCAATGGAGATTACTCTTACAATACAAAGAGTTATCCAGCCCAAGTTGGCGTCGCCAATCATTCGCCAGAATACCCCACCCAAGAATGACAGCCACCTTATCAAGTTAATCAGTGGAGAGGCACCAGCCCCGTCTAAACCAGACCTGAAGAATATCCCTCATGTTGCTTTGTACTTAACCATCACTTCCAGTGAGGACGATGATGAACCTGATAAGGACATCCTTTACCAGTATCCAAAATCAGAGGCAGCAACCAAGTTAGTCGCACTGAGGGGAATGTTCCTGACCTTGAGTGATTTAATGTCATCAGTAACAGGCAGTACGGCAAACAGCTCAACATTAGCGCTGGACAAGAAGCTTGTTCATGTTGTGTATTCCAAACTGGACAGAGATGTGTTGGTCATTGCTATGCCTGCAGAGAAAATACCTCTGGTTCAACTTAAGAAAGCAGCTGCTGATGTTACTCAAATTCTTTCTCTCACATTTGGATCAATGCAAAGGGCATTCTGTGACAAGTTTAACAAAGCGCGTGTAGACCATCTTTTTTCTTTGCTGTTTGAGAAAGCTCTTGCGAAGCCCCCTGGCGCAAGTGATAAAGATTGCATCAATAAGCTGCCAGACCTTTTGCCTGGTGTACAGTGGCTGAATCTACCTTTGGCAACGGAGGTTCATGTTCACTGCTGTCTCAATGACTTGGAGGCAGCGGATTATGGAGAATTTGCAGATGAATTTTTTCAAATTAGAAGATTATATACAATTTTAGGCTCCAGTATATTTTATAAGGGATATTTAGTCGCCAATCATTTAACCAGAGAAGATTTAGAAGATGCTGTATTATATTGTAAATATCATTGTTTATTGGCCATGAGTGCAGAGCAGAGAGTTGGTCAGTTGGTCGTCTGGAGAGAGGTTTTTCCAACAAGAAGACAAAAATCCAGATCTGAGAACAGAAGACTTTCAAGAGAAGGAGATGAGGAATACTATGAACCAACTGCAAGATATTTTTTACTCATTGTAGGCATGAAACACTGGCTCATGTGTGTCCTGTTAGAGGCGGGTGGTATCTCAAGACGAGCCGAGGGTTACCCTCCTCCAGATACCTACTATGTGGATCAAGTTAAAAACACACTGCATCAGATTGAAGCCTTGGACATTCCGTCTGTTTGTGAATCGAGGTTGAGAAGTCCAAACAACCCTCCATTAGCCTCAGCAGATATGCTGCTCATGAATCCACCAACACCGCTGCTAAAATCCTCATCAAGTGTCGGTGGCGGCTCGGACACACCTACCCAGCAGAAGAAGCACAACAGTGTGGACAACCTCAGACTACAAGATGAAGTCGAGTCCTCCGACAGTGGCAGTGTACCCTCGACTCTTCGTCGGAAAGGTTCGGACAGCTCCGGAAGTATGGGCAGCTTCGGCACCAAAGGCAAACTGAGATCGTTCCGGTCCCAGTTCTCTCTCAATTCTGCCGGCACGTTCAGGAAGAGCTTGCCTGAAAATATCCCCGACCTGTCACAGATGGTGACGGCCAAGTTGACCGGTGGAACAGAGAACACGTTGTTTCATTACGTCAGTTGGGATTCATTCCATGGTATTGTGGTGTGTCCAAGCGATGGAGACGCACCCTCCACGGGTGGGGCAGTACATGCTGATGTGGTGAACACATTTCACAAAACCTGTCTGTCTATGCGTAGATTGTTTTCTCCTTATTACAAACAGCGGTTAAAACAAAACGACCGTCGACCTCGATTTACGTCTTCTGGAATGCAGGGTGTGATAGAACATGGCGTGCTCTTTCACAGGACTCCAGAGAACTCAGCGGAGCAGAAGAAAGTTCCTTCAGTCCTCAAGTACTGGGTCATAGGGCGCCTTTTACCAGGGGAACACCCTCGGGAATTGTACGTGTGCCACCACCAATCGGTGCCCCAATGTGCTGTGGAGTTGGCCTTCAAACTGGGCTTTGGTGTATGA

Transcript

OS493_008242-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1MDL2	Protein inturned OS=Bos taurus OX=9913 GN=INTU PE=3 SV=2
Q059U7	Protein inturned OS=Mus musculus OX=10090 GN=Intu PE=1 SV=1
Q9ULD6	Protein inturned OS=Homo sapiens OX=9606 GN=INTU PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002100 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19032 all species →	Intu_longin_2	Intu longin-like domain 2	Domain	Interproscan
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF19031 all species →	Intu_longin_1	First Longin domain of INTU, CCZ1 and HPS4	Domain	Interproscan
PF19033 all species →	Intu_longin_3	Intu longin-like domain 3	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043988 all species →	Domain	CCZ1/INTU, second Longin domain	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR039151 all species →	Family	Protein inturned	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR043987 all species →	Domain	CCZ1/INTU/HSP4, first Longin domain	Interproscan
IPR043989 all species →	Domain	CCZ1/INTU/HPS4, third Longin domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21082 all species →	PROTEIN INTURNED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0001736 all species →	Biological Process	establishment of planar polarity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005929 all species →	Cellular Component	cilium	Interproscan
GO:0007399 all species →	Biological Process	nervous system development	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22862	INTU, CPLANE4, PDZD6; protein inturned	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008242-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

32.8Max TPM

17.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.17	27.61
polyp at pH7 6	18	18	18.59	26.86
coral polyp · control treatment	16	16	19.68	27.21
coral polyp · oil and dispersant treatment	16	16	17.15	24.44
coral polyp · oil treatment	16	16	17.97	24.76
coral polyp · dispersant treatment	16	16	15.14	32.80
Polyp	10	10	10.29	17.08

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.61
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.71
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.67
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.10
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.34
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.83
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.70
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.27
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.04
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.69
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.65
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.86
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.94
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.64
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.20
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.64
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.25
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.76
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.06
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.31
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.98
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.79
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.71
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.95
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.14
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.09
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.34
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.84
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.21
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.76
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.25
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.08
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.13
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.38
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.04
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.58
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.89
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.49
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.86
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.92
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.44
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.55
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.47
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.66
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.16
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.91
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.51
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.11
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.11
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.19
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.86
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.08
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.93
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.03
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.53
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.93
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.50
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.16
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.57
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.70
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.37
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.62
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.89
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.85
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.52
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.54
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.49
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.80
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.60
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.09
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.90
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.60
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.03
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.39
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.10
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.69
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.57
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.45
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.71
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.08
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	14.61
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.37
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.66
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.24
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.49
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.40
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.25
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.16

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.