Gene detail

Detailed information of OS493_008269-T1 in Lophelia pertusa

Genomic Location: scaffold_19:2023377...2053633
NR annotation: KAJ7393021.1, cGMP-dependent 3',5'-cyclic phosphodiesterase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008269-T1

ATGGTTCTTGCGCTCTTACATATGATAGTTTCAGCTTTGTTGTCGCTGATAAACATGTTCAAAAACTTGGCGGAAGGTGACAGAGGCGAAGCGAAACGATGTACATTGCATTTGTCTGTTGCCGCGCAAGATGTTCTTTCTTGCCTGACCTTAGCGATCGACATGAAATCATTGAAAGAAAGCGCTGAGAGAGCGATACATCTGCTTCTGCCGCGAGTGGTAGATGTGGTGGTGTTTGTCTTGAGCCCTGTCTCAGGTGAACTAGAAGCTCTTGGAAGGTCTGGCATCAATACACCTAAGATACCTCAAAGTGGAGTTGTCAGGGAGGCAATAGATGGTAAACAAAGAATTGTTTTACGTGGCATCAAGAAAGATGATCCTTCTTTGGTATTTATACCATCAGCCGAAGTACCCTTAGAAAGTGATCAAAGAAGTGATCAAAGAGTGATATTGTCACCACTGTATACAGATGATAAACTAATTGCATTTCTCATGATTGTTTCTGGTTTCTTAGAGGACACTCTTTCCATTCTGGAGTTCACTGAACAACAGTTACTTCAAAGCTATCATCATATAACTGAGAGAAGTAAATATGTTCATGAATTTGAAAGACAGAAGACCTTTCTAGAGTTCTTTAGTAGGGCTTATGAAAAGGAAGTGGCACCTTTGTCACGTAAAATAGGAGAATTTCTTCAAACACAGACTAACGCTGAAGGCAGTGCTGTTCTTATACTGGATCACACAGCAGGCGAACTTCACAACATGCAAGAAAGCAAAGATTGTGTGGATGATAAGAGAATTGAGGTTTCTGGAAGTATTTTTGAGGATGTCATTGAATCTAGGAGAAAATTAAATGTTTCTAATATAGAAAAGGACACAAAGTACAGATATGATTTAGAGAGAATAACAGATTGCTACATGTATGTCCAGTCAATGCTGTGTGTTCCAATAATCAGCTTCAAGACAGGCACTGTTATAGCTGTAGCATGTGTGTTCAACAAAAGTCTTCCAGAAAGAAGGTTTTCTTCCTTCGACGAAGAAAATGTCCAGTTTTGCTGCGAAAATATCGCAGCACATGTAGAACACACATTGGAGTGGGAAAGAGAGATGGTGATTAAAAGACAACAAGAGCATTTACTAAAGGTTGCCAAGAACCTGTTCACCCTTGTAGATGATGTCAGTGTCTTACTAAGTCAAATAATGACAGAGGCCCGCAATTTGACTAATGCTGAAAGGTGTTCTTTGTTTCTATGGGACAAAGAAAGAGATGAACTTGTTGCCAAGGTGTTTGATGGAGAAATTCCCTCGGATGGAGACGACGGAAAGGAACCAGAAGTAAGGATTCCCGTCACGCAAGGAATAGTGGGACATGTTGCCATAACAGGAAAGATGCTAAACATAAAGGACGTATACAGTCATCCATTGTTCTATAAGGGTCTCGACGAGAAAACTGGCTTCAGAACAAGAAATATATTGTGCTTCCCCATTAAAGATGAAGAAGAGGTGATTGGAGTAGCACAGTTGTGCAATAAGACGAATGGTTCTTGTTTTACAATGTTTGATGAAGATCTCACCAGAGCATTTGCTATCTACTGTGGTGTGAGCATTTTCCATTCACTTTTATACAAGAATGCCAAAGACGCCTCGCACAGAAGTCGACTGTCAAGTGAAATGATGATTTACCACATGACGGTCACTCAAGCCGAGGTGGATCCGCTAATAAATAAACCAATTTGCACCGCGGAAGAAATTGACCCGCAGTTTCGTCTTTTCACATGTGCGCCGAGAACTATTTTCATGGATTCTACGATTCCAGCCTGTCTTTCTATGTTTGAAGACCTTGGAATGGTAGAGAAATGGAAAATTCCAAAGGAGGTGTTAATAAGGTTCTTACTAATGGTAAGAAAAGGTTACAGGAACCCTCCTTATCACAACTGGAGTCACGCATTCACTGTAACGCACTTCTGTTACCTTCTTTACAAGAATGCAACGATTACCAGTCACTTGAGAGACATTGAAATGTTGGCATTGTTCGTGGCGTGCCTGTGCCATGATATTGACCACAGGGGAACCACAAATTCCTTCCAAGTTTCCTCAGTAGGTAGACAATACTGGTTTTCCCGTTTCCACGTTGTGTGGCTTTCTAATTTCGTGTTTGGTTTTGTTTACTTGCTTCCAATGGTTGCTTTTCTTAACAGGGGTCCACGCTCGCTGCGCTGTATAGTTCAAAGGGATCTGTCTTGGAGAGACATCATTTTGCTCAGACCATGTGTATACTCAACTCAGAAGGATGTAATCTTTCAAAAATTTAACCGGCAAGGACTTTGA

Transcript

OS493_008269-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q922S4	cGMP-dependent 3',5'-cyclic phosphodiesterase OS=Mus musculus OX=10090 GN=Pde2a PE=1 SV=4
P14099	cGMP-dependent 3',5'-cyclic phosphodiesterase OS=Bos taurus OX=9913 GN=PDE2A PE=1 SV=2
O00408	cGMP-dependent 3',5'-cyclic phosphodiesterase OS=Homo sapiens OX=9606 GN=PDE2A PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002981 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00233 all species →	PDEase_I	3'5'-cyclic nucleotide phosphodiesterase	Domain	Interproscan
PF01590 all species →	GAF	GAF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029016 all species →	Homologous_superfamily	GAF-like domain superfamily	Interproscan
IPR002073 all species →	Domain	3'5'-cyclic nucleotide phosphodiesterase, catalytic domain	Interproscan
IPR003607 all species →	Domain	HD/PDEase domain	Interproscan
IPR003018 all species →	Domain	GAF domain	Interproscan
IPR023088 all species →	Family	3'5'-cyclic nucleotide phosphodiesterase	Interproscan
IPR036971 all species →	Homologous_superfamily	3'5'-cyclic nucleotide phosphodiesterase, catalytic domain superfamily	Interproscan
IPR023174 all species →	Conserved_site	3'5'-cyclic nucleotide phosphodiesterase, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11347 all species →	CYCLIC NUCLEOTIDE PHOSPHODIESTERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004114 all species →	Molecular Function	3',5'-cyclic-nucleotide phosphodiesterase activity	Interproscan
GO:0004115 all species →	Molecular Function	3',5'-cyclic-AMP phosphodiesterase activity	Interproscan
GO:0004118 all species →	Molecular Function	3',5'-cGMP-stimulated cyclic-nucleotide phosphodiesterase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005741 all species →	Cellular Component	mitochondrial outer membrane	Interproscan
GO:0005743 all species →	Cellular Component	mitochondrial inner membrane	Interproscan
GO:0005759 all species →	Cellular Component	mitochondrial matrix	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0010628 all species →	Biological Process	positive regulation of gene expression	Interproscan
GO:0010754 all species →	Biological Process	negative regulation of cGMP-mediated signaling	Interproscan
GO:0010821 all species →	Biological Process	regulation of mitochondrion organization	Interproscan
GO:0019933 all species →	Biological Process	cAMP-mediated signaling	Interproscan
GO:0019934 all species →	Biological Process	cGMP-mediated signaling	Interproscan
GO:0042803 all species →	Molecular Function	protein homodimerization activity	Interproscan
GO:0043951 all species →	Biological Process	negative regulation of cAMP-mediated signaling	Interproscan
GO:0046069 all species →	Biological Process	cGMP catabolic process	Interproscan
GO:0047555 all species →	Molecular Function	3',5'-cyclic-GMP phosphodiesterase activity	Interproscan
GO:0048471 all species →	Cellular Component	perinuclear region of cytoplasm	Interproscan
GO:0097060 all species →	Cellular Component	synaptic membrane	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008081 all species →	Molecular Function	phosphoric diester hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18283	PDE2A; cGMP-dependent 3',5'-cyclic phosphodiesterase	EC:3.1.4.17	Morphine addiction	ko05032	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008269-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

130.8Max TPM

10.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.73	10.91
polyp at pH7 6	18	18	8.92	14.50
coral polyp · control treatment	16	16	15.64	130.84
coral polyp · oil and dispersant treatment	16	16	11.38	87.72
coral polyp · oil treatment	16	16	8.75	17.01
coral polyp · dispersant treatment	16	16	8.63	16.90
Polyp	10	10	7.42	14.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.73
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.42
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.30
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.19
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.62
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.61
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.55
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.40
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.36
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.75
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.33
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.59
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.50
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.94
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.94
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.54
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.84
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.48
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.18
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.15
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.04
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.83
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.74
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.46
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.17
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.62
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	130.84
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.94
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.16
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.67
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.85
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.29
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.94
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.89
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.90
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.41
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.11
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.60
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.72
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.74
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.74
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.74
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.83
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.60
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.48
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.97
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.29
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.17
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.25
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.01
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.87
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.94
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.25
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.97
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.81
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.17
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.35
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.64
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.29
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.90
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.39
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.23
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.27
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.33
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.90
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.54
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.09
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.63
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.06
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.78
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.47
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.92
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.52
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.23
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.01
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.21
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.73
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.38
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.15
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.19
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.95

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.