Gene detail

Detailed information of OS493_008400-T1 in Lophelia pertusa

Genomic Location: scaffold_19:3295896...3316042
NR annotation: KAJ7393101.1, hypothetical protein OS493_008400 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008400-T1

ATGTGCTGCCATGTTTATAGACTCCAGGGACAAGGAAGTAAAGCATGCTTTTGCTCTCATGTTTGTGGAAATCCTTCTTCCTGTGGCTGCGGTGCCAACAGAGAGCTGAATGTGCCTGCTTTGAAGTCCTTTGTGGATATGACGTATCATCATGCTGTTGATCTCACTAAGAAGACCAGACATAGTCAACCAAAAGGCCTTTTTCCTCAGCAGTTGGCCAAGTTTCTTGGTTACATGCTTGGGAACTTTGAAGCAGAGAGATGTAAAGATGCAGAAAGTGGCCATGGAATGTTATACAGATTAGTCTGGGTTTACATGGTCAGAATCAAGGGAGAGAGCAACACGGCAACAGTAAGTCGTCTACGAAGCATCACTGATGTGCTCTTTCCTCGGGGTTCCCGTGCTGTTGTTCCAAGAGAAGCTCCCATGAACTACTTTGTGAAGATCATACAGTTTATTGCTCAGGAAAAACTTGACTTTGCTATGAATGACATCATCTTTGACTTACTTAGTGTTGGCAGAACAGCACGGGCGATAAGTCCAGAGAGAATGAACATTGGTCTCCGTGCATTTTTTGTCATTGCTGACAGCCTCCAAAGAAAGGCTGTTGAGGCTCCAGCTATGCCAACCTCTACCACCTCTCTACCATCTGGCAGTACTGTGAGAGTACGAAGAGTTGCTTCTATGAAGAATCTGACTGAGAGTCAGGCCAGCAGTATTGGACTAGCAAACTATTACCACAGCATCCGTAAGGCCCTGGACAGCATCATAAGAGCGTTAGATGCACAAATTGGCAGACCCATGATGATGACAAATCCACATTGTTCTCACAAGGAGCCAGAAGAAGTTGCTGCGGGTGAACGAAAACCAAAGGTTGATCCAAAAATTGAGTTGTTCAGAACTTGTATTGCTGCCATTCCAAGGTGTATTCCAGAAGGCATGACTAAAGCAGAACTTGTGGACCTTCTTTCTCGTCTAACTGTTCACATGGATGAAGAATTGAGAGGGCTGGCCCTGTCATCTCTTCAATCCCTTGTGCTTGACTTTGATGACTGGAGAGAAACCACTGTCTTAGGCTTTATCAATGTTATTCTGCGTGAGATCCAAGATAACCTGCCATCACTGCTGGACAGTGCACTGCGCATGTTGTTACAACTGCTGGCTCACTGGAAGACTGCTGTCTCTGCTGGTCCTGGAGATAAGTCTGGACAAGATACCCAGCTGGAATTGTCTGCTCACAGTCTGCCGTGTGAGAAGGAAGTTGACAGAATAACTGTTCTTCACAGTGTGGAAGGTTTTGCCCTTGTCACGCTCTGCAGTATACATCCTGTGATACGAAAGCTGGCCTTTCTTGTACTGAAGGAAGTACGAATATTATTCAATTTAATGGACCTCAGTGAGAAGGAAAAACCTGAGAAAGTTGTGCTTGACGTAATAGACCAAGTATTCCCAACAGTTCTTGAGAAAGTTCTGCATTCCATGCCACAGAGTGAGAAGCTCTTCACAGGACCATTAGGCAATGTTGATATCTTGGTTGTGAACGAACGTCTGTCTGGTAACATGGATAAGGAGACAGGAGAGCAACTGAATGTCGGATTGCACAGTTTCTTCTGGTCATCCCTTATGGCAGGTCTTCTGAACAAGTGGTACCTGCCTGAACTCTGTCCTTCTGCACTGCAATACAGTTGGCCTAATGTCTTCAATCGCCTTCTCACTGTTTACTCCTTAATTGATTCAGGTGCATCAGGAATAGATTCCATCACCAGTCTGTCATCAGTGTACAGCAGAGGACCAAAGAAAACCATGAATATGAACCATGTCTGCTTGTTTAGAAATTACCTGATCTTCGCTTGCTGTGCATATCCACGAGTACCACCCCTGAGGAGCGACTCTCCAGACCAGGACGGGGGTACATCATCAGAAGGATCAGAAACCAAGGGTGACTCCAGAAGCGATTGCTCTGATATCAGGGAGGCAGTGATTGTTGGGCTTGGAAGGACTAGCCCGTGCTCTTACAGAGAGTTAATTGAAGAACTCCACTTTCTTCTCCGGGAGGCTCTGGACAGACGAGCGGAGAGCGTTAGAAGACGAAGAAAGCGAGATGTACTGAGAGCATATTTGGTCAGGATATTTGAGCTCAATGCTGAACATGGCTGTTTCCGTGACAGTGCCAGTGAGCTGGTGATGGAGGATGGGTTATGTGCAACATTTATTGAATATATCGATGGAACAAGATCATACCTGGAGAGCGAGAGTGAAAAAGACATGCCCGCTATAATGCAGCTGAGACTTCACTTTGCCCACTTCCTCTACAAAATGATCACCTCGGTCTCTGCTTCTCTTCAGAGGAATCTTCTACCTGATGACATGCGCTGCAACCTGTTTTTCCTGTTTAGTAGTTGGTGTGCCCACTTTGGAGTCAAGACCCCTGGACTTGAAAACACCTCACTTGTTCCAAGTGCACAAAGCAATGATTTGGAGCTGGCTTCTCTTCATGTTATGTGTGGCTTGTTACAGTGTGGTCCTGTTTTTGATCCTAATAATCTCATCACCGGTGGTTATCTTTACAACTGGTTACAAACTGTTCTCAACTCACCCAAAGAAAAGATCCATCAACTGGGACACGATACACTGGTACACCTGCTGGAGAACAACGCCAATATCCCGTCCCTACTCCACTGGGTTATAGACAAGTGCTACACGGGTGCGAGGCTGGTGGTCAGTGGCTGCTTCAAGGCACTGGTTTCTGTTTTTACCAAGAGTGAGTATCCTTGTGAGATGATTCCTATTCTGAACGTGGTGCTGTTCAAAACTGCTGATTCTTCACTGGACATCCGAGGAAAAGGCGGCTCAATTGCTACAGCTTCTAGAAAGACGTTTCTTTCCATTTACGACACCAAGCTTGTCATGCGCATTTCGGTGTTCGTACTCGCAGTGTCAAAGGACCTTGTCTCAAGCGCTAGCTACAGCTCACCCTGA

Transcript

OS493_008400-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O94915	Protein furry homolog-like OS=Homo sapiens OX=9606 GN=FRYL PE=1 SV=2
E9Q8I9	Protein furry homolog OS=Mus musculus OX=10090 GN=Fry PE=1 SV=1
Q5TBA9	Protein furry homolog OS=Homo sapiens OX=9606 GN=FRY PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002627 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14222 all species →	MOR2-PAG1_N	Cell morphogenesis N-terminal	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR039867 all species →	Family	Protein furry/Tao3/Mor2	Interproscan
IPR025614 all species →	Domain	Cell morphogenesis protein N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12295 all species →	FURRY-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000902 all species →	Biological Process	cell morphogenesis	Interproscan
GO:0005938 all species →	Cellular Component	cell cortex	Interproscan
GO:0030427 all species →	Cellular Component	site of polarized growth	Interproscan
GO:0031175 all species →	Biological Process	neuron projection development	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008400-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008400-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

25.7Max TPM

8.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.55	12.45
polyp at pH7 6	18	17	6.95	12.60
coral polyp · control treatment	16	16	12.18	25.67
coral polyp · oil and dispersant treatment	16	16	10.17	18.74
coral polyp · oil treatment	16	16	7.27	13.04
coral polyp · dispersant treatment	16	16	9.80	17.33
Polyp	10	10	2.43	5.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.45
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.24
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.63
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.49
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.19
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.06
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.01
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.93
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.84
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.23
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.84
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.78
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.13
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.87
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.60
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.60
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.72
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.47
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.96
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.26
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.74
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.06
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.49
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.37
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.33
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.33
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.20
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.67
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.56
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.31
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.30
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.07
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.95
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.53
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.51
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.48
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.80
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.25
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.64
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.84
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.73
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.89
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.74
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.72
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.46
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.38
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.77
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.46
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.38
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.38
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.94
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.48
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.95
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.04
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.20
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.19
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.17
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.66
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.51
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.23
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.49
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.45
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.71
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.45
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.55
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.07
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.72
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.33
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.40
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.60
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.16
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.94
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.91
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.75
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.50
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.86
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.35
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.58
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.18
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.01
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.51
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.35
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.67
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.50
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.01

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.