Gene detail

Detailed information of OS493_008401-T1 in Lophelia pertusa

Genomic Location: scaffold_19:3316810...3336803
NR annotation: KAJ7393102.1, hypothetical protein OS493_008401 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008401-T1

ATGACTGCACGATTTGAGATGACGTCCCCTGTAGGTCAGCGGTGTATTCTGCAGTACATGCTCCCTTGGTTGGCAAACATAGAGCTGGTTGACTTGTCAAACTCCTCTCCCACTCCCCCTGAGTTAAACATAGAGACTGACGAAGAGGAACAGACAAGTGCTATGTCTCCTGTGGAGCTAGAGGGAGAGGGGTGGGGATCAGTCGAAGCTACACAATTGGTGCTTAACAATCTTTTCTACATCACTGTTAAGTATGATGAGCAGTTCTCTAAAGAGATCGAGGAGGCCTGGGGCAGCCTGTGCGGCAGTCGATGGGTGAACAACATTCATGAGATACTTGGATATCTGATAGCACTGGCTGGCGTCATTGGAAGTTCAGAAGTACTTGTTCATGCCAAGAAGCTGGCAGTGTATGTAGCACGTGCAAACCAACAGAAAACTATCGAGGAACTTATGGAAGAACTCAAGCTTACAGAAACTGTGGCATCTCAGTTCGAGCGGTGTGACGATGCGCCGTTTTTTCGTTCCCTGCAAAAGTCGTCAACCAGTCGGGACTCGGGCAGCAAGAAAAACGTATCCAAAGAAGATACAAAACCAGACGATGAGCTGTCCAGAAAAGAATCAAGAGACGAGAGAAAGGAATCGAAAGAAGAGAGACGAGATGCTAAGGATGAGAGGAAGGAAAAAGGCGATTCTCTTCCCAGGGGTTTGGAGAATGCTCCTATGCCCGAGCCGTCAAAATCACTGGAAACTACCGTGCCATTGGCGGAGCCAGAAGAAGAAGATCAGATTGAAGAGGAAGAGAAACCCGAGGGGGCCTGGGCACATGAATGGGTCATCATGGCGCATAGGCTTGTCAGTGCTGGCGTGACTCTTTCCTTACCAGTCCCCGAGAGAGAAAAATACTTTGCGCCACTTCCTGATATCCTTCCGTTTGCACCGTACGTGGCTTCTCTGTACAGGTGTAACTTTTCTCTGATGCTGTTAGCTGAGTTAGTTCTTGATCAAGCCTCAGTTGATTGGGAAGAACATCTACCTCTCATGCTTCATGTTATTTTTCTAGCTCTGGATCACGGCAAAGCCTTGGTTTACGAACACAGCAAGAGGCTGTTGATCAACCTCATTATAGTGCTGGTGTGCCGAGGCGACCACGTGTCTTTAGCTCAGTCCCTCTTCAACTTCATCACCATTTCAGAGCAAGGTCTTGGTAAACACGGTCTGTTAAAATCCTCGTGGACACTTGATGTCGGTAATATCGTGGGTGTGGCTGGTCCTAGTGCGGGCGCTGGGACTGGTGCTGAGTTTGAAAGGCAGGGTCCTTCTGTGGAGAGTAATGTTGCTAGTGCAGGCACTAGCGCGTCTGTGTCTGCTGCTGGCAGCAGTTCTCTGAACCAAGCTCTACCTCCTGAAGAAAACACTGCTAACAGACTTGTGGAGCAGATACAAGAACTCATTGAATTTCTAGCGAACAGTGATTGTAAACCTCTGTGGGCGTTTGAAGAGATCACGCCTCGTTCATACAAAATCAAAAGCGCTGAGCAGCTGGAGCTGTTTGTTGCGTCAGTGGTGCAAATTTTCCAAGCCTCAGATTCAAGCAGTAAAGTACAGGAGAAGATGGCCAAGGTGGCACTCCACTGGGCCACATCATGCTCCTCAAGGCACTATGCTGGCAGGTCCTTCCAGGTGTTCAGAGCTCTTAAGGTCCCTTTCTCCTGGTCCATGCTCTCTGATGTCCTGTCAAGATTGGTAGAGTCTGTTGGTGATGGCAGTGAAGATGTACAGGGTTACGTCATGGAAATCCTCCTGACACTCGAAGCAGCTTCTGATTGGACAATCGTGGACCAATCAAACACAAGCGAGTTGTCGAGTGGCCTGGACCTTGGGCTAGGGTTTTACCTGGAAGATGAAAAGGAAGATGTCGTCGATGAATACAACTTGCACATCTTGAGCACAAGCGCAGGATCAATCAGTCCGCTGTCCCGGATTAGACAGGGCGGGCACATGCGCTCTCTGAGCAGCGGGTGTGAGTTTAAGAGGCATTCGTCGCTGTTTAATCATTTTGGACGCTTGAACGGCACCAGGGATGAATCTCATCTCAGGGCAAGAAGCGTCAGTGTGCAGTGTTTAAAGACACCATCGGAAGCCATTAATCCTCAGAGCCAAGCGGACATGGTGACTCGTGTGTTTTGGATCGCTGTCTCTTTACTCGAGTCTGATTATGAACATGAATTCCTTATGGCCATCCATCTACTGAACAAGGTGCTGTCGTTTTTGGACTTGAGTCGACATTCTTCTCGGGAGAAACTCGACAAGGTTCTTCACAGACTCAAGTGGAGTGATTTCCCAGGACTACAAGCGCTCCTACTCAAGGGTGTAACAAATGCAGCTACCTCTGAGCCTTCGCTTCGTCTGCTGTCCAGACTTACCGTGTTCTCAAACGTTGGTCTCGTGGACCCGTCCCAGGCCGCTGGTTTTGCACTCAACATGTTGGCGTTGTTGCCACACATGCTGGAACATTTTGACGAACCAGACGAGTTCAGCAAGACGTGCGCTCAAAATATAGTGCAGGTTTGCCATGGTTCGGGGAACCTCGCTCATTTAGGCAAACTGTTCGAGATGTACATCGAGAAATCCTATCACAGACCACGATCCACCTGGCTTGACTCAGTGTGCAGATATATCAACGACTCGTTTGGACATCTCACCAGATCACACATCACCTTCCTATTAGAGGTTTTAGAGCGTGGTCCGCCTGTTTATCATCAAGTTGTGTTGGGCGTGTTGTGTGCACTGATGCGACTGGCAGACTTCTCATCACCAGCCATGAGACACTTCCAAAACGATGCTCTCAAGACAATAGCCAAATATCTCAAGGGTTATCTATGGAAAGAGTCACTTGACATACTAAAGATGGCACGCCGAACACGTGAACGCCTCGTGAACGTGCTTACAACCTGTGGTCACACGGTAGGATTAAAGCAAAGTCCATCAGTTGTGTTCAGTTCGAGCAGTGATCTTGCAGTGGAGAAACAAGGCGCAGGTCAACAGCCCTCGTCTGAGGAAACATCCCTGGCAGAGGGACTGACTAATGAGACCGGCAAGGATGAACTCGAACCACAACAGATAAGTGTGCTGACAAATTTCGACTTCCTGTACGACGACGAGGCCGAAGACGTCTTGTGGGGGCCTGAGTACGAGGATCGTCGCTTATCGTATTGCAGCTTGGACGTGGGAAGTCTGGATCGAGACTTGAAGTCCAATCTGCAGACTCTGGAGTGTCTGTCAGGCAGTGAACAGGATCTGACTCCACATGACTCCTCTGATGACGAGGACGAGCTTACTCGCTCCTTAACCAGCAGTACGCTGACCGCAGTTACCGACAGCACATCAGCAATAGAAAGCTCGTCCGAGTCCTCCGCTAACGTGACTGTGGTTGCAATAGACTGTGATGACAAGAGTAAGGAACAGGCGATGGAGAGCCGCAGTCCATCTGTAGAAAGCTCGAATTCGTTACCAGGCGCCTCTGACACCAGTTACTCGTACAAGCTGTTTGCCGTCACGGAGATCACGTGGGACTCACGTGATGAGCCCGAGAAGCTGTGGACAGCGCACGTGGGCTCCATTGTGAAGGACACGTTAGGCGTGACCGCCGTTAATACTTTCTCCCTGTTCTGTTGTCTGTACAAGAGCACGCGTCGGAAGTTCTACAGTTTGACACGGGAATGCTGCAACTATCTGGTCGAGGACAAGTTTCGAGATATAGCACATCACTTCTCGAACACTTTGGAGTTTTTAGTGTCGCGTGGCGAGTGTCCATTCGTTTGTATCGACACAGAGACTCTAAATCGGACAAAACTGCTGGAGAGGCACAAGTTTGCCGTGTTGGAGCTTCATTCGCATTTTTCGAGCTACGTGCAGAAGAGCGAACGCACGCTGGAATGTCTAGATGATGTGAAACTGGCGGTGAAACGTTCCTCTGTTGGTTCGCATCACGAGGAGCCAGAGATTCGCCTCACACCGGACTCTGAGAATCAAGAGATGAGGCAGGTGCAATTATGTCGCTGTCTGTACAAGGCGCATTTCCAGTTCTTACTGTTCTGTAGCACCTATGCCAGGCTCTTGGAATCCTTGGTGCAAGCTGCTCGCCAGGCTGAGGTAAACGATCTAACTCAGGAGGTCAACGAGATTCGCCGGGAGGTGTCGTCGGTTCTGGAGCACCCTCTCTCGGAAGAAGACAGCGCCTTCATCAAGAGTTACGTGGACAACGACTCCTTGACAAGAGACTCGGCTGTGCACGTGCTGGTGGATGAGCTGGTCGGCAGGGAGATTGAACGCTCCATCCATCTCGTACGAGTCTTTAGGGACAAGCTTGGCGGAGAAGCGTTTGGTACTTCGGACGAGGACAACCTAGACTGCTTAGTGTCTTTCTACTGCAAGCATGTAGCAGAGAAAAATGTTGGCTCCCTGGTCATGTCAGGCTCATTACAGAACTTCTCGTCCTTGTGTAGAAATCTTATGGAGGTCAACGTTGCTATACTTGCAGCCGTTGAGGATTTGAACGTGTAG

Transcript

OS493_008401-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E9Q8I9	Protein furry homolog OS=Mus musculus OX=10090 GN=Fry PE=1 SV=1
O94915	Protein furry homolog-like OS=Homo sapiens OX=9606 GN=FRYL PE=1 SV=2
Q5TBA9	Protein furry homolog OS=Homo sapiens OX=9606 GN=FRY PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002676 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19421 all species →	Fry_C	Furry protein C-terminal	Domain	Interproscan
PF14225 all species →	MOR2-PAG1_C	Cell morphogenesis C-terminal	Family	Interproscan
PF14228 all species →	MOR2-PAG1_mid	Cell morphogenesis central region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR045842 all species →	Domain	Protein furry, C-terminal	Interproscan
IPR025481 all species →	Domain	Cell morphogenesis protein C-terminal	Interproscan
IPR029473 all species →	Domain	Cell morphogenesis central region	Interproscan
IPR039867 all species →	Family	Protein furry/Tao3/Mor2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12295 all species →	FURRY-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000902 all species →	Biological Process	cell morphogenesis	Interproscan
GO:0005938 all species →	Cellular Component	cell cortex	Interproscan
GO:0030427 all species →	Cellular Component	site of polarized growth	Interproscan
GO:0031175 all species →	Biological Process	neuron projection development	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008401-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008401-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

32.5Max TPM

15.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.24	15.99
polyp at pH7 6	18	18	11.07	16.73
coral polyp · control treatment	16	16	22.08	32.55
coral polyp · oil and dispersant treatment	16	16	18.60	31.12
coral polyp · oil treatment	16	16	16.65	30.29
coral polyp · dispersant treatment	16	16	16.61	28.30
Polyp	10	10	7.76	14.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.99
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.65
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.20
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.14
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.07
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.85
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.84
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.12
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.59
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.22
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.97
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.96
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.12
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.06
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.73
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.23
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.69
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.48
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.09
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.28
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.19
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.53
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.19
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.05
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.03
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.76
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.61
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.92
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.71
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.65
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.13
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.55
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.13
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.89
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.72
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.34
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.69
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.88
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.84
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.23
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.27
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.77
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.37
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.12
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.69
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.22
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.17
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.40
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.38
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.43
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.07
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.85
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.79
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.60
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.29
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.05
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.76
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.72
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.36
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.07
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.08
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.87
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.48
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.17
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.79
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.34
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.26
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.11
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.30
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.10
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.18
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.50
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.78
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.22
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.35
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.12
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.88
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.83
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.68
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.69
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.48
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.27
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.95
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.58
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.56
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.72
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.91
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.80
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.77
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.45

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.