Gene detail

Detailed information of OS493_008417-T1 in Lophelia pertusa

Genomic Location: scaffold_19:3418634...3425067
NR annotation: KAJ7393118.1, hypothetical protein OS493_008417 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008417-T1

ATGTTGGCGTTGTTGCCACACATGCTGGAACATTTTGACGAACCAGACGAGTTCAGCAAGACGTGCGCTCAAAATATAGTGCAGGTTTGCCATGGTTCGGGGAACCTCGCTCATTTAGGCAAACTGTTCGAGATGTACATCGAGAAATCCTATCACAGACCACGATCCACCTGGCTTGACTCAGTGTGCAGATATATCAACGACTCGTTTGGACATCTCACCAGATCACACATCACCTTCCTATTAGAGAGCGTGGTCCGCCTGTTTTATCATCAAGTTGTGTTGGGTGTATTGTGTGCACTGATGCGACTGGCAGACTTCTCATCGCCCGGCATGAGACACTTCCAGAACGATGCACTCAAGACAATAGCCAAGTATCTCAAGGACGACGGGCCACGCCAGGGGAGCTTGGGAAGGAGAACAAGCTCCTATCCCCGGTGGCCACAGTGGATTTGTCAGCGTGGAGAAAACCACATCTTTCTCAGCGGCGAACACCGTGAACGCCTCGTGAACGTGCTTACAACTTGTGGTCACACGGTAGGATTAAAGCAAAGTCCATCAGTTGTGTTCAGCTCGAGCAGTGATCTTGCAGTGGAGAAACAAGGCGCAGGTCAACAGCCCTCGTCTGAGGAGACATCCCTGGCTGAGGGACTGACTAATGAGACCGGCAAGGATGAACTCGAACCACAACAGATAAGTGTGCTGACAAATTTCGACTTCCTGTACGACGACGAGGCCGAAGACGTCTTATGGGGGCCTGAGTATGAGGATCGTCGCTTGTCATTTTGTAGCTTGGACGTGGGAAGTCTGGATCGAGACTTGAAGTCCAATCTACAGACTCTGGAGTGTCTGTCAGGCAGTGAACAGGATCTGACACCTCACGACTCCTCTGATGACGAGGACGAGCTTACTCGCTCCTTAACCAGCAGTACGCTGACCGCAGTTACCGACAGCACATCAGCAATGGAAAGCTCGTCCGAGTCCTCCGCTAACGTGACTGTGGTTGCAATAGACTGTGACGACAAGAGTAAGGAACAGGCGATGGAGAGCCGCAGTCCATCTGTAGAAAGCTCGAATTCGTTACCAGGCGCCTCTGACACCAGTTACTCGTACAAGCTGTTTGCCGTCACGGAGATCACGTGGGACTCACGTGATGAGCCCGAGAAGCTGTGGACAGCGCACGTGGGCTCCATTGTGAAGGACACGTTAGGCGTGACCGCCGTCAATACTTTCTCCCTGTTCTGTTGTCTGTACAAGAGCACGCGTCGGAAGTTCTACAGTTTGACACGGGAATGCTGCAACTATCTGGTCGAGGACAAGTTTCGAGATGTAGCACATCACTTCTCGAACACTTTGGAGTTTTTAGTGTCGCGTGGCGAGTGTCCATTCGTTTGTATCGACACGGAGACTCTAAATCGGACAAAACTGCTGGAGAGGCACAAGTTTGCCGTGTTGGAGCTTCATTCGCATTTTTCGAGCTACGTGCAGAAGAGCGAACGCACGCTGGAATGTCTAGATGATGTGAAACTGGCGGTGAAACGTTCCTCTGCGCATTTCCAGTTCTTACTGTTCTGTAGCACCTATGCCAGGCTCTTGGAATCCTTGGTGCAAGCTGCTCGCCAGGCTGAGGTAAACGATCTAACTCAGGAGGTCAACGAGATTCGCCGGGAGGTGTCGTCGGTTCTGGAGCACCCTCTCTCGGAAGAAGACAGTGCCTTCATCAAGAGTTACATGGACAACGACTCCTTGACAAGAGACTCGGCTGTGCATGTGCTGGTGGATGAGCTGGTCGGCAGGGAGATTGAACGCTCCATCCATCTCGTACGAGTCTTTAGGGACAAGCTAGGTGGAGAAGCGTTTGGTACTTCGGACGAGGACAACCTAGACTGCTTGGTGTCTTTCTACTGCAAGCACGTAGCAGAGAAAAATGTTGGCTCCCTGGTCATGTCAGGCTCATTGCAGAACTTCTCGTCCTTGTGTAGAAATCTTATGGAGGTCAACGTTGCTATACTTGCAGCCGTTGAGGATTTGAACGTTTAG

Transcript

OS493_008417-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E9Q8I9	Protein furry homolog OS=Mus musculus OX=10090 GN=Fry PE=1 SV=1
Q5TBA9	Protein furry homolog OS=Homo sapiens OX=9606 GN=FRY PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002676 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14225 all species →	MOR2-PAG1_C	Cell morphogenesis C-terminal	Family	Interproscan
PF19421 all species →	Fry_C	Furry protein C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025481 all species →	Domain	Cell morphogenesis protein C-terminal	Interproscan
IPR039867 all species →	Family	Protein furry/Tao3/Mor2	Interproscan
IPR045842 all species →	Domain	Protein furry, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12295 all species →	FURRY-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000902 all species →	Biological Process	cell morphogenesis	Interproscan
GO:0005938 all species →	Cellular Component	cell cortex	Interproscan
GO:0030427 all species →	Cellular Component	site of polarized growth	Interproscan
GO:0031175 all species →	Biological Process	neuron projection development	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008417-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008417-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

39.2Max TPM

16.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.93	28.69
polyp at pH7 6	18	18	16.82	28.75
coral polyp · control treatment	16	16	22.32	39.19
coral polyp · oil and dispersant treatment	16	16	18.45	33.98
coral polyp · oil treatment	16	16	16.21	32.73
coral polyp · dispersant treatment	16	16	14.79	35.01
Polyp	10	10	7.49	14.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.93
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.45
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.69
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.46
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.80
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.12
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.85
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.54
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.30
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.74
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.97
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.42
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.84
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.75
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.87
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.45
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.35
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.52
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.96
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.03
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.48
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.47
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.06
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.01
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.81
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.68
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.19
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.33
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.94
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.97
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.65
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.77
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.04
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.20
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.58
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.00
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.94
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.98
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.19
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.87
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.08
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.03
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.52
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.48
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.71
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.14
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.68
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.93
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.87
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.73
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.63
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.92
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.46
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.71
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.26
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.83
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.44
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.90
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.36
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.32
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.22
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.01
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.11
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.17
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.36
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.70
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.40
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.60
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.82
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.51
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.31
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.18
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.21
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.03
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.87
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.33
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.17
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.64
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.31

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.