Gene detail

Detailed information of OS493_008510-T1 in Lophelia pertusa

Genomic Location: scaffold_20:593133...603093
NR annotation: KAJ7386386.1, Protein fem-1 C [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008510-T1

ATGGCGGCGAGACAGGAAGACCTGGATCGCGTCTTTAGCTGTCAGCCGATTCCAATCATCAAAGCAACGTGTTTTCGTGACTTCGTACAAGAGATCGTTCCCAAAATCACCGTAGAGAATCTCAAAGCGATGAAACGCTTTCTTCGAGATGTAATCTCGTTGAAAATTGGTGTTAAAAATTGCGACTCTCCCGGCGGACTGCTGGAGGAACTTTCAAGATGTCACTGTGTGAACGAATGTGATTTGGACTTGTTGGAAGATCTACTCGGGGTAACTGGAAGGAGCGATGTTTTAGATATGCTGCGCGAGTTTAAAAGGAAATGCCCTTCAGTTTTGGAAAGTATGTCCGAAGAAACGATTAGTGAGTTGGTCCCAGCCCATGGAAGATCAATTGTTTCGTTCATTTTACATGAAAGTGCATACGACACCACGCCAAACAGGGTGAATTCCTTCAAGAAAAACTTATGCAAACAGTTAAAGTTGGTGCGTGCTGAGGTGGCTTTTATTGCCATAGTTAGGATTCCAAGAAAACAGCTGATATTTCAGCTGCCATTAGAGGCACTTCCACTCCTGCGACATTGCACTGGATGGAGAAAAGAATGGCTCTTTTCTCTAAATGTCAGTGGTGTACAAATCTCTGGAGAAGATGAGATTTATGTTCAAGAACTGAAAATATCTCAGCTCAGACTACAAGAAGATCCAGTTCTGGTGTCTCCTGTGCTGAGAGTCAGCGAAGCTGCACGAACAGGCGATGTTCCAGAATTGAAAAGAGTACTTGATGGCGAATCAATAACCAAGCGAGACTTCCTGCTTAAAACTCGCACGGATGGAGCAACACCATTGATAATAGCTTCAAGGAATGGAAACACTGCCATAGTCCAGTGCCTCCTTGATGAGTATGATGTTGATCTGGAGCAAGAGGGAACTGTTAAAATTGATGGCGACCTGATTGAGTGTTGTACGCCGCTGTGGATGGCCTCTCTTGGGGGTCATTTGGCGATTGTTAGGTTGTTGTTGGAGCGAGGGGCAGAGGTGAATCACACAACACTGACTAACTCCACCCCACTGAGGGCAGCTTCATTCAATGGGCATACTGAGGTTATACGATGCCTTATTAAACATGGGGCAGATGTAAACAAACGAAATCAAGATGGCAACACTTGTATAATGGTGGCTTGCTGGAATGGACATCTTGGTACTTTTGGTTTACTGCGCACATCAGGTGCAAACATGGATGTACACGACAATCAGGGGTTCTCGATGATTCACTGCGCTACAGCTGCCAACAACCTTACACTGTTACACGAGCTCCTACCGTTACCAAATGCCACTGCAGTGAATGCCAAGACCTCCGAAGGTATCACTCCATTGATGTTAGCATGTGAAAAAAATCACCCTGACGTTGTGCTGTTGTTGTTACAGAAGGGTGCTGCAGTGGACGAAAAGTCTGATAAAGGTCTTACTGCGGCACATTTCTGTGCACTGTCAAATGATATAACAAGCTTGCATCACCTTATAGATTACAAAGCAGATCTTACTAAAGCCACTGAGCGAGGTAGTACTGCACTAATGCTGGCCTGCGCCAAGGGATATGTTTCCATAGTAACTGCACTGCTCAGGAACACTTGTAAGTCAAAGTTGAAGAGCGAGATCAGCTCAGCGCTGAAGCTGCGAAGCTTGACAGGACAACCAAGTTGTCTTGGGCTTCTGTCAGCATCGAAAGGAATAGACATCAATGTTGGGAATGAAAATGGTGAAACATGTTTAATGATGGCTTGCGAAAAAGGCAGTGTGGAAATTGTTCGGATTCTGCTTGATGAAGGAGCCGATCCTAACTGCGCAGATCAGAATGGTGTGACCCCCCTAATGATCTGTTGTAGGCGTGGTCAAGAGAGAATCGTACCCCTTTTACTGAGGAAAGGGGTGCTGGTGGATCATAAAAACAATGAAGGTGACACAGCCTTGCACATTTGTGTGCGACATTACCGTGAATTCAGTGGACATAAGAAGTGTTTGGAGCAGCTGCTTAGTACTGGAGTGTACACGGAAATCAAGAATTCTTCGGGTGACACTCCTGTCACAGTTGCTCTCAAAAGCAAAACGTGGTGCGGTCAAGCATTTGAACTGTTGCACGGTAGGGGACTGGAGCTCAGTACGTCACTTCAAGACATACATGGTGACACAGTGTTCCATAAATGCGCACGATCCGGCGATCTCTTATCCATGACATATCTGCTAGCCCTAGACAGTAGAGGACCGCTACAGAAGAACCAAGATGGCGACACGGCTCTCAGAGCGGCGGCGCTAGAAGGATCCGAAGCCATGACACGCACTCTGATCAACACGGTCAGCGGATTCCCAGTGAAGGACAAGGCAGAAGCACTTGAGCTGATAGGCGTTGGGTTATTGGCTAAAGAGATATCACGTGACTGGGATATCTCTGCAGTGGTGGGATTCTGGCAGGAGGCCCTTGTGCTTCGCCGCACTCACAGTCTTACTCTACCCAAGATTATACCACGTGAGTTTCCACTGGAGTATTTCTTGGAAGCGAGGCTGCCCAGTGATCTGACCGCGTTCGAGTCCAATCCGAGTGCCGTAACTGCGCAAGCGCTGCAGATTTGTGACCGCGTGTTGGGTGACAAACATTCACGCCTGCCCTCCCTCCTGGGGACTATTGGCGAGAGGTTTGCGCAAATTGGCGAGTTTTGTCGCAGTTTGAACATTTGGCTGTACGTGTTAGAGATACAACTCAAATGTCTTTCATCATCGCCGGACGGGGTTGAAGATGTCCTTAACACTTTCCGTTGCTTTGCTGATGCTTTTGGGTTTGTTCTGAGCCGAAGTGGAAGTGTTTTGCATTTTAAAACAGTCTAA

Transcript

OS493_008510-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZM55	Protein fem-1 homolog B OS=Gallus gallus OX=9031 GN=FEM1B PE=2 SV=1
Q9UK73	Protein fem-1 homolog B OS=Homo sapiens OX=9606 GN=FEM1B PE=1 SV=1
Q9Z2G0	Protein fem-1 homolog B OS=Mus musculus OX=10090 GN=Fem1b PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010727 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR001875 all species →	Domain	Death effector domain	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR011029 all species →	Homologous_superfamily	Death-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24188 all species →	ANKYRIN REPEAT PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0042981 all species →	Biological Process	regulation of apoptotic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008510-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008510-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

8.4Max TPM

3.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.54	4.00
polyp at pH7 6	18	17	2.49	4.03
coral polyp · control treatment	16	16	4.87	8.40
coral polyp · oil and dispersant treatment	16	16	4.28	6.53
coral polyp · oil treatment	16	16	3.52	5.80
coral polyp · dispersant treatment	16	15	2.92	5.44
Polyp	10	9	1.15	1.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.00
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.59
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.56
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.50
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.43
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.34
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.01
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.63
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.60
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.95
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.71
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.66
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.86
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.03
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.45
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.43
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.27
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.18
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.12
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.02
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.58
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.33
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.49
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.25
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.92
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.59
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.84
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.56
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.17
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.08
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.11
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.53
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.67
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.67
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.44
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.56
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.55
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.20
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.54
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.30
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.98
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.80
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.92
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.76
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.36
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.53
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.90
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.40
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.40
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.78
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.67
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.24
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.11
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.96
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.63
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.51
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.66
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.78
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.72
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.42
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.41
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.20
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.03
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.42
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.