Gene detail

Detailed information of OS493_008630-T1 in Lophelia pertusa

Genomic Location: scaffold_20:2389560...2397910
NR annotation: KAJ7386496.1, hypothetical protein OS493_008630 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008630-T1

ATGTCAGCCCTGGTATCAATACCGGACTCCAAGTCTGACACCGAAGTTACACCGGAAGAGGCAAAGAGACGTGAAGACATATTTCAAGATTTTACACAGTTTGCAGCTCAAATCTTTGTTGATCCATTTAGCATGGATGAAGTTCCTAGATCTTTAGAAGGCCGTACAAAGGGACGATTTGGTTCCTCCAAAGATCTGCTTCTTCACAGCAGTGCTGTACACGATCTGTTCTTCCGCAGTTTTGTGACGTCAGCCTTTGCAGGTTTGCAGCATGGGCAGCAGGTGAGCATGCGAGATGTCCAGTCAGCGGTCGATGCCTGCGTGGAAAACTTCCTTGAAGTTGACATCACAGAGTTTATCCGCACTCTCTGTGGACACTACGTGAGGAACAACAAGAACAAAGAGACCTTTACAGAGACAAGGATTAACGAGGAGCTTCAATCTGTTCCTATTCGCTTGCCGTCGTTATCCATTGAGGAACGCATTAAGGATTTGAAGAAAACCTTGTGTGGAGAATGTGAATCAGTAACTGGTCTTCACAAGTCTATCACTGCAAAGTTTTTCTCAATTCTTGGAAGATACTTCAAAGCAGTTCCACCGAGCATGGATCACTTTTTCTATTGTCCACAGCAGTCTGATGGCCCAAGAAAGTCTGTCCCAGAGTCTTTCTCCGAGTCTGAAACCTACGAAGCAGAGCAGGCTGCTGAAGACGAGGCTCAAGACAAAGACAGCGATGTGGGCTCAGATGCGGCCTTTGATGATGTGGACACTGGTATCTTGATAGAAGATTTTGGGTCAGTTCCACAGTACGAGATGGACGACTTGTCCGATTTTGAAAGCCAAGGAAGCGATAGTGAGTTTGAAAGAGATACCGAGGATGATCAGGACATCAAGTCACCTCTGTTCCTACAGCTGACATGTTCGCTTAGAGACAGGAGTAGCCACGGACAACCTATGACTCCTGTCTCTATCAACACTTTACCCGTCTGCCTAGGTGAAATAATCCGCAAGTTTGAAGACGACGACGAATGCCTTGATCCCTTCAGTCCATCAGTGCGTATCAGCCTTGACCTCATTTGCCTGACCCTCTCACCCGAGCCTGATTACTCAGTTCTCAAATCCTCTGCTCGAAGTACTCCATCACGCTCCAATTCATTCTCCAGTACAAGCTCTCTCATGTCCGTCTCCCCTCAGGATAAAAGATCAGGGATGTTTGACTTTAGACGGCAAGATTCTAAGGCTACTTCACATGATATTGACGGAATTGATAGCTTGGATCCCCTTCATGATCTTCTTCATTCTCAGCGCCAAGCATTGAACATCACCTGTGATGCAATACGCTGGCTTTTACAAGACGAAATAGTCTCCGAGCTCCGTCATATTGGGCCTGTAAACAAATCAATGCTAGAAAAAGTTGAGGCTCACGTAAAACAGTCTGAAGATCACTCTTCCTGCATATCTCGTGACGTTCGTCTGCACTTTGTTTTTGGCGCTGAACAAAGCATGGAGCTGTTTGTAAAGGAATTCAAAAAGATCAACTTACCAGAATATGTGTTGAACAACACTGAGAAGTATTACTATTTGACTAGTTTTGTTGAGAAACAGGTCGCTGTTACCTTGCCGTTGGTTCTGGAAGGAGATACAAGTGATTCAGTGAGACAGTTTGAGAAATCACTAGAGGATCAAAATGATGCTTTAACTCCAAAAGCCGTTATGGATGCCGGGAAGGGAACCGAGGAAATTGCGATTCCTCTTGAAGTGGAAAATACTGTTGATACACACACTACAGCTAATGAAGGTCTATTAGCTATTTATGTTGAAAAGCAGTCGACAATTACTCAACAAGAAGAGAGTAATGATTTGGACTCCTCTATCGGACCACTGGCGGTTACTGTATCCCTTCAAGAAGACCCCAAGGAAAATGAACCGAGCACCCCGCCCTCTAAACATCCGCATCTTGGCGAGGTAGGCAAACAGCACCCCACGCAAGAGGAACCAGATAGCCCTGCTGCAGCCACCCCGGTAAAATACTCTTCTTTTGCTTCCTCTGCTGGTAGCACCCCGGTGGGGAAGCTGATCATACCTGCTGCAGACGTAAGCACGGCTGACTCCAGTAACACGGCAGCAGAGGATGACGAGAGTGGTACACCCAGTCCGTGTACACCGCGCCAAGAAGAACACAGTGATGAGATAGCCGAGAAATACTTGCAGTTCTGGCTTGTGATGAGAATATTTGATAATGAAGTCGACATCTTCTTCCATCGAAGAGAGTCAGATGATCCTAAATCGTTTTGTGCAACAAGAGCTAATGGTTTGGTTGAGATGGTCACGAACTCTATTCATGAAAAATGCCGCATTGTCAATCAGCGCATGTTGCTACACGAGCTATACGAGACCAAGAAATGTAATTCATTGTTGTTCCCTGAATCAGACGAAGATATCTGGAAGCACGAGGATGTTCAAATCTCGGTGTCACCTCTTGGAGTTCATATCAGCAAAGGGGATAGCAAAGGTCGTGTCACCAGTAAGTTTGTTCAAGTACAATTTCTATTTCAACCCGGACATTTTGGCTGCAACAGTGTATGGTACACTCACCTACCCGTGCACCAGAGACTCTTTGATACTTCGGGTCGGACCGGGATCTCCCGCGGGTTGAAGGCTATTAAGAGTGTGTTGGACAGGTTTGGAGTGAGCAACAGGAAAGACATGTTTGTTTACAAAGATGTCAGTACTGGAGCTGTTTTCTACTTCAGGTTGTTTGAGTCTCTGTGTTCCAGTGACTCCTCAAATCAGTTTCCATCTGAGCTCCGCGCTCCAGACGATGACGATGATGAGTGTCGCTCAGGGATGTCATCAGTTGCATCATTGGCTGGTTCAAGAACGTCTTCACAGTGGTCTTTAGTGAAACCAGGCGAACTGGATGAGGAAGTCATTGAATCAAAATTAAAGAAACAAACTTCAGCTCCTGAACGAGACACGATTAGTGACAGCGGCCGAAGCATTCAGTCAGTACAACCCGTGATAGACAAGAGCATTGCACTTCATGTATACGGCGTGGATGAACCCGGCCCTGAGATCACAGTGGAACTAGTTGAGGTTTTGCAGAACAGAATTAATGAAGCGATGCTGGAAGTATTGTCAGTTCTTCTCTCCAGGAATCCAAACTGCAAATTGACATACGCTGATGTCCGATTTATACAACCACAGGGCCAAGCACCTAAAACAACCCTCACCTTGATAATCCCGCCTATGGACGTAAACTTCCTTTGTCCATTGGCTTTCTACTTGCGTCAAAACCTGTTACAGCTTCTGCACACTCCGAGATACATGGACTTGAACACCAGCCACCATTTTAAAGCCGTGAGCGGTAGCAAGACAGAAGCTACTGGTAGTGCCAGTGGCGAGAGCTGTAGGTTGGAGCCGGAGATTTACTTGTATAACAGACCACACTCATCTGGAGGAAAAGGTTTGAGATCACTACATGTATCTATATTGTAA

Transcript

OS493_008630-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2A9C3	KICSTOR complex protein SZT2 OS=Mus musculus OX=10090 GN=Szt2 PE=1 SV=1
Q5T011	KICSTOR complex protein SZT2 OS=Homo sapiens OX=9606 GN=SZT2 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001887 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_008630-T1 in Lophelia pertusa.

InterPro

InterPro term	Type	Description	Source
IPR033228 all species →	Family	Protein SZT2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14918 all species →	KICSTOR COMPLEX PROTEIN SZT2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005777 all species →	Cellular Component	peroxisome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008630-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008630-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

17.6Max TPM

5.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.77	8.10
polyp at pH7 6	18	16	3.97	6.94
coral polyp · control treatment	16	16	7.83	14.58
coral polyp · oil and dispersant treatment	16	16	6.41	17.63
coral polyp · oil treatment	16	16	5.13	8.59
coral polyp · dispersant treatment	16	16	5.60	9.74
Polyp	10	9	1.10	3.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.05
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.87
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.98
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.90
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.78
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.76
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.75
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.61
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.84
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.08
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.19
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.06
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.69
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.42
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.85
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.76
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.60
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.90
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.27
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.92
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.89
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.33
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.58
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.98
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.59
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.33
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.35
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.12
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.43
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.42
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.04
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.85
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.45
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.63
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.82
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.46
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.12
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.09
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.60
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.08
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.42
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.01
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.79
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.15
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.98
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.84
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.64
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.06
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.05
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.40
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.97
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.33
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.78
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.73
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.29
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.21
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.83
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.36
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.72
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.15
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.74
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.10
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.26
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.11
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.93
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.32
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.10
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.83
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.57
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.47
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.41
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.85
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.28
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.53
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.34
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.07
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.33
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.22
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.