Gene detail

Detailed information of OS493_008709-T1 in Lophelia pertusa

Genomic Location: scaffold_20:3336965...3347602
NR annotation: KAJ7386566.1, hypothetical protein OS493_008709 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008709-T1

ATGAAGCTGTTCCGAGGCAACTTTGACCGGTTCTCATTGGTAGAACAGCCAGTTGATCCACCTGTTAATGGACATTATCCTGTGATTTCTCGACCTGTTGTCCGTCCTGTCATTAAACCTGGCCGTGGCTGTTCCAAGGTTGCGCTTCGCTGCTACTTTAACATCCGGGGACGAAGAAAAAGCCGAACTATAGCACGTGTGCAGTGGATTGTGAACAAGAAAGTGACTAAAGCAGAAACTGTACGGGGAACTTATGCCGAGCTCTTGGAAAACACATATGGCTTCAAAGCTGGAACAACGGTCGCATGTCGGGTAAGGGCACGATATTCCAGTGGAAAGGATTGGACAATGGACCAGAGAAGTAAAGACTTCTTCGCAGGCATCAAGGTTAATCCTAAGGCACTTTCAATGACAGACAGCTCCAGTTGGAAATTGATCAAACTGCGCACCTTAGTTCCAATCAGATGCCGCGGCCGTAGGAGATGTTCTGTGAATCTAAAACTTCAATCTCACACACGTTTTGTGACTGACAAGTGCCGAATGACCCTGATAGAAAGAAATAGGAAGAATTATGGATTTTATGTTAAGCCTGTGCGAGATTTCAGAAAACTGAAGAGGCAAAATATCCGTGTTCGATTCAGCCCTATAAGGTCTACCCCTGGCTTCTGTGGATTTTGGAAGGGATACAGACTTCCAACAATCAAGGTCATAACGTCCAACAGAGGTTTCAAGAAATGTCAGGGAACCGGAGATCCGCATTATCGAACATTTGATAAAAAGTATTACGACATTTTGAAGAACGCTGGAGATTACGTGATGACGAAGAGTTTAAGAAGAAACTTTGAGGTGCATGCTCGTCTTGGCCTTGTTGGAGAGTGCCCACGTGTTATTCAGAAATCCAGACAGCCTCTTGGAAACAGAATGAGGATCCGAAGATATGGATCTGGTCAAAGCACGCGTTTTAAGGTCATGATGAAGTCCGGTGCAGTGGTTGAAGCTAAAGCTGCATACTGGGGAATGAGTCTCTACATCACAGTTCCTGGTATAGATACTGCTGCTACTGTAGGACTCTGCGGAAACAACAACGGCAATGCAGCTGATGACCTCGAGAGAAAGAGCATCTACACATTTGCCAATAAGTACAAATTGCGGCCTGGTACCAGTCTCTTTGACAAGCTTCCACCTCGCATCTCAACTGTACGCGGACGCGTCAAACCATCTTGCGCATGCGTCAAGAAGGGCAACCGCCGTTTCAACACTTGTGACGTCAAGCCTATACCAGACACGGACAAGGGCGGGAAACCTGTTAAACCAATCAAAGTTCGGCCTCGTCCGAAGAAACCCGGGAAAGGCGATAATCGTGATTATGACCCGAAATCTGTGAATTATGTTTTCAAACCTCCTAAAGTTAACTACCGTGTTCCCACCTGGCCAACTCCGACTGGAATAACTCGCAAGAAGGCGATAAGGCATTGCAAGCGGGAAATGCGTAGGTTGATGCGTGTGTGTAAGAAGATTGTTAGTGCCAAGAAGCTGAAAGTCATGACAGAATGCGTGACGGATATTAAGATTTCAGGAAAGCTATCCATGGCCAAGTCAGCATTATCCAGTCTCCAAGACGCTTGTAAAACCGCAGCTCTAGTCAATCCCAAAAACTACAAGAAGAAGAAGGGCAAACTTGTACCTAACACAAACATCATCAATAAAATCAGCTGCCCTGACAACTGTAACAAGCGAGGACGATGCGTCAAGGGCAAATGTCGCTGTAATCGCGGTTACGCTTCAAGTGATTGTTCTGTAGATAAGAGAAAAGCACCCAAACTACAAGGACTGCAGTCAAAGGGATTGTGCGACTTAAGGAAACGTAACTGCCGGTTTGCCAGTGTGTATGGAAGTGGTTTCTGGGAAGGTCACTTGAACTGTCACACACAGAAAGCTCGGTTGGCGCGTCGCAGATGGCATGGAATCGGTGGACAAAGAAAAAACCGCGGCCATTTACAGAGTTTCAGGGAAGCAAGATGTAAACTTCCTTTCAAATTTCCCAAAGCAAGAAAGCTTCGTGGCTTACCACTGAGATCGTTGGTGTCCATTTCCAATAATGGTGTCTTGACCAGCAATCGGCTGAAGTTGATAATCTTCGACTCGGCATGCCATAGATGTTTAGCAAATGGACAGTGCTGGCCAAAGTATCACAGCAGTACAAGCCACTAG

Transcript

OS493_008709-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000020 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_008709-T1 in Lophelia pertusa.

InterPro

InterPro term	Type	Description	Source
IPR050969 all species →	Family	Developmental Signaling Modulators	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14949 all species →	EGF-LIKE-DOMAIN, MULTIPLE 7, 8	Interproscan

Gene Ontology

No Gene Ontology signature was recorded for OS493_008709-T1 in Lophelia pertusa.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008709-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008709-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

104TPM > 0

7Conditions

16.0Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	4.91	11.67
polyp at pH7 6	18	18	3.63	10.11
coral polyp · control treatment	16	16	6.61	15.02
coral polyp · oil and dispersant treatment	16	16	4.30	11.02
coral polyp · oil treatment	16	16	4.12	11.27
coral polyp · dispersant treatment	16	15	5.29	16.05
Polyp	10	6	0.46	1.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.67
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.61
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.59
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.36
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.11
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.64
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.85
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.57
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.65
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.12
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.75
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.72
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.95
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.53
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.11
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.33
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.94
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.90
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.20
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.08
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.27
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.40
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.32
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.34
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.27
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.46
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.21
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.75
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.38
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.93
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.22
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.11
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.09
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.23
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.62
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.08
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.02
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.06
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.98
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.28
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.41
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.37
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.56
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.56
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.46
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.97
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.15
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.69
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.56
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.09
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.01
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.80
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.65
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.58
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.05
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.66
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.29
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.89
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.46
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.58
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.10
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.66
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.71
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.94
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.84
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.45
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.17
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.