Gene detail

Detailed information of OS493_008720-T1 in Lophelia pertusa

Genomic Location: scaffold_20:3452509...3461043
NR annotation: KAJ7386575.1, zinc finger protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008720-T1

ATGAGAGGAGAAAATAGCGATCTTAACTTCAAGGACTATTCAGATACAGTAAGATACCTTGAAGAACTGCAGGAAATAAACCTTAAAACATTCACGGCTGAACTACAGAGAAACGAAACTGGAATTTCTGAAGAGACGACTGCCAACAGGGCTGTGAGGTCCCCTGCGCCTTTTAACGACATTATGTATGGATCTGGAGCTGGGTTATACGCAGGTCGAACACAAGGGCCGAAATTTGCGCGTCAAGCGCATGAAGCGTCTTTGGCGTCAAGAGTGAGAAATTACAGTGGAAGTTACGAGTCTTTTAATCAAGCAGAAATTAGTAGCGGTGTCGGGGGTGCAAAAGTGATTCCGTCGGAGAGAAGTGCAGCCATGTTTGATTATCATTACACAGATCACAATACACATGGTGGAATGTCCACATCAAGCGGTGTTAACTTGCCGAGCGCGAACAACACGCAAAATGGATTTGCGGCGGAAAATGGCCCCGCGCACTATTCCCAAGGTGTTGGAAATGGGTGCATTTCTTCGACACTTCAGCAGTCAGTTAACATTAACCCTCTAGCTGGCTTATCAGAGCTGGCCGAGAAGGCAAACTTCGTGTCTGAACTCGCCAGGAATGGCGTCTCTCAGTCTCGGTTTAGCTCTCAAGGAAGTCGCGGCCAAATAAATCGCCCGGCTCGCCAGTACTGCTACCCAGAAGCACCGAGAGGCAGGAGTTGGTCAAGCTCGGCCTCTGATGGCGCTGCTGGCTTCTTCAATGGGCGACAACAGTCGTTTCAAGCTGATAACTTCTCGCCGTCTCTCTCAACAGGGAGTTCTGCGCTATCAGACTCTGATCTTGGCAGTCCATGCCAGTCGACACGAGCGCGGCAGTTTTTTCCGTACAGTGAGTCCGATTCGGACCTTTCACCAACGGAATCAAACCACGGGTACGCGTTTGATAGATCAAGGGCATACCAGAACTACAATCCTAGATCGTTCGCGAATTATCGGGTGTGGAGTAACCAAGCGGACTCCGTTACTCCTAACGTAACGGTGGTTCCCGACCCGAGGAGCAAGCTATCGCAATTGTTCAAGTCTGGAAGCCGATCGAAATCCTCCGAGCAAATTCTCAAGGAACATTTGCAAACGTTTGGGAAGTTTTTGTCTCCGCCAGGGGACAAAGAAGACGAGAAAGCGCCTCTGGTAGACAACGAGAAGAGTTGGAATGGCGGAGAAGAATCGATTAAAGAAAAGAAACCACCTACGACTACATCGAGCTCGGTCAAAGACGCGCAGCTTCCCAGTAACGAGGAGAGCAGTGTGTGCCCTTGTAAGTGGGTTGGGTGTGATGGACTTTATTCCGAACAAGATGACTTAGTTCGGCATATTGAGAAAGTTCACATCGACCAGAGAAAGGCAGACGATCTGTATATCTGTTACTGGAAGGAGTGCAGCAGACAACGTCGCGCGTTCAATGCTAGATATAAACTGGTGATACACATGAGGGTACATTCAGGCGAGAAGCCCAACAAATGTACGTTTCCGGGATGTAATAAAGCATTTTCCAGGCTAGAAAATCTTAAAATACACATGCGATCGCATACCGGTGAAAAACCATATCTTTGTCAGCATCTTGGCTGCCCTAAAGCATTTTCAAACTCATCTGACAGAGCCAAGCATCAAAGAACACATCAAGACACGAAACCATATGCTTGTCAAGTTGCTGGCTGTCCCAAGAGATACACAGATCCAAGCTCACTAAGAAAGCACTTTAAACAACATGCAAATGGCAAGATGCCTCAACAGAACTCTAGTGGCAAGTCTAAACAGAAACCAAGAGGAAACCGATCATCTAAAAGAGACCTACTCTGTGCAGGAGTGACAAGACCTTTATCAGACTTCAGCTTTGTAGACGAGTATCAAAGAAAACGACAGAAAACACTGGATACATTGCGTCAGACAACAGAGAAAAAAATCGCTCTTGAAAGTAGTTTTACTCAAGCTCAACTTGAAGCTGAGAGAGCTTGGTATGGAACAGAGAATCTGTATGGACAGTACAACCCGCCACCACTACAGCCTGTCGCAAGGGCAAGCACCCCCACGCCTGAAGAAGAAGCAGGAACCTTCCGCTATACTCAAATGTTAAGCAGTATGGAGATACCAACATTTGAAGACACGCTAAAGCCGTTATCAAGTGGATATTCATAG

Transcript

OS493_008720-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NEA6	Zinc finger protein GLIS3 OS=Homo sapiens OX=9606 GN=GLIS3 PE=1 SV=5
Q6XP49	Zinc finger protein GLIS3 OS=Mus musculus OX=10090 GN=Glis3 PE=1 SV=2
Q8NBF1	Zinc finger protein GLIS1 OS=Homo sapiens OX=9606 GN=GLIS1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004801 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00096 all species →	zf-C2H2	Zinc finger, C2H2 type	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043359 all species →	Family	C2H2-type zinc-finger protein GLI-like	Interproscan
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45718 all species →	TRANSCRIPTIONAL ACTIVATOR CUBITUS INTERRUPTUS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000977 all species →	Molecular Function	RNA polymerase II transcription regulatory region sequence-specific DNA binding	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09232	GLIS1_3; zinc finger protein GLIS1/3	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008720-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

114.9Max TPM

32.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	22.00	29.09
polyp at pH7 6	18	18	25.19	39.23
coral polyp · control treatment	16	16	42.80	112.79
coral polyp · oil and dispersant treatment	16	16	54.14	114.91
coral polyp · oil treatment	16	16	30.93	61.21
coral polyp · dispersant treatment	16	16	29.58	49.82
Polyp	10	10	17.78	50.38

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.09
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.67
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.97
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.08
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.83
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.77
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.33
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.92
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.59
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.75
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.50
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.01
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.83
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.29
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.32
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.23
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.24
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.62
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.66
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.78
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.47
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.22
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.44
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.87
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.95
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.76
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.36
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.93
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.33
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.66
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.03
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.59
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.33
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	112.79
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.12
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.63
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.10
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.02
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.76
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.91
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.42
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.73
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.52
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.94
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.45
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	114.91
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.99
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.22
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.95
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.92
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.39
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.93
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.67
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.81
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.27
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.73
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.48
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.27
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.21
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.46
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.27
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.28
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.84
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.25
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.39
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.16
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.34
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.82
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.29
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.82
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.43
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.77
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.85
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.69
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.38
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.74
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.83
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.94
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.18
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.87
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.14
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.90
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.93
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.17
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	50.38
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	24.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	18.78
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.05
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.56
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.49
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.91
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.07

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.