Gene detail

Detailed information of OS493_008749-T1 in Lophelia pertusa

Genomic Location: scaffold_20:3775929...3779015
NR annotation: KAJ7386601.1, hypothetical protein OS493_008749 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008749-T1

ATGGAAGCAAGAGGACAGTCATCTGTTGTTATTGAGTCTGATCACCATTCATCCTCGCAAACTTTATGGCCTCTTCGTCAAGCACTTTACGCCGAATCTGTAGGAACAGACGATGAGGAAAATGAAGACGAATTATCGCGTATTTGGTGGGTAAAAACTCGATGGTTTCAGCGTCTGGTCCAAGTGTGCGCTGTCGTTAGTTTGACTTCTACGGCGATGAATTCGCCAGATACATTTTTACTATTCAATTCGCTGAACTACATCACTCTTGTACTAGATATTGTGGTTGCCATTGTTTTCACCACCGAAATGATCGCACAGATAAACATGTGGGGCCTGTGGAGTAAACAGAAGGCATACTTCAAGAAACCGCAGTGTATTTTTAATGCGAGCATGCTGTTCCTCATCATTCTGTCGATCTTGTTGCAAATTATTGAAATTTCTGGCTACATCCCTGCTAAATATTTTGCATTTTCTATTCCAAGAGCCCCGAGGGCGCTGATAATAGTTCGATTCTTTAATGTACTCATCACGATCAATTTGCCGAAGTCTGTGGCGCGCCGCTGTAAGCGACAAATCTGGGCCGTCACTCTGTTCTTGTTGTATTTCATGGCGTTCGGATCAATTATTGGCGTTCAATTATTCGGACGCAAAAACTATTATTGTGTCAAGGACGGCGCAGATTTGAATAACTTGACATACAACGATCTACTACTGACGGATCACCGATGCAACAACGAGAATGTCACTGGTGAAAGAGGTTATTTCTGTCCTGGAGGATTTCGTTGTCTTTTCGTCGATTTCCAAAAGAAGGATAAAGATTACTTCGGAAATTTCCTTCTCAGTATTTTAACCGTTTATGAAAGCTCCACGCAAGAAGGTTGGGTTCTCGTCATGTACCGAATGATGGACTTCCGATCGCATCCCTTAGTGATCGTTTATTTTGTGTTGCTCATCTTCTTCGTCGCGTGGCTTGTAAAGAACGTCTTCATCGCTGTGGTGTCGGAAACCTTCGCCGATATTCGGAGCATGTACATGTATAGTCGGAAATCTTCGAAGCGCACGTCGGCTCGGCTGGCTTCTCAAGTTATCAAAGACGGTGGTACCGGATGGCATTTAATCTCGGTGGATCATGAAGCTGCCAAGGGGCATGCACCATTGCGCATTCGACAAGTTGTTAACTCTATTTACTTTCAATACACAATGATTTTGTTTGTTGTGGTTGACGCTATCCTACAAGCGACTAATTATCCATGGCGGAGATACCCTCAGTTTGCCTTCACCATTATTTTTGACCTAGAAGTTCTCCTGAAGATATCTTGTATGGGTTTTCGCCCATACCTTCTCCGTAAAATGCAGCTAACAGAGTTCATACTAGCTGTTGGCAGCACGGTTTTTGCGTTACCAATTCTCATTTCTGATACAGCAGCTTTCCTGGCTGTGTTTAACGTTATGAGGATAATTCGACTGATTGGCGCAATACCGAATCTACAAGAGTTCTGCGAGAAAATCTTCGGTACTGGAAAGAAACTTGGAGCGGCCATTGTATTCACGCTGTTCTTTGTAATGGTTTCATCGGTGATAAGTATGCAGTTCTTTCTAACTTTGGACTCTAAGCGGTTTGGTACCTTTATGCTTTCGGTACAGTCCATGTTTCAAATCATCACCCAGGAGGGGTGGGTGGAGGTTTTGGATGACCTAATCAACGAGACTAACAACACATTTGCGACGATTCTTGTCGCGATCGTTATCTTAGCTTGTCACCTGTTTTCCTCGCTGATTATTATGAGCGTATTCGTGGCAGTCATCCTGGACAACTTGGAACTTGATGAAGAGGTAAAAATCATGAAACAGAAGAAAATGGGCGGAGAATGCCGAGAATCCACCGAGGAATTACCGCTGCGTCTTCGGGTCTTCGAGCGTTTCCGGGACGACCCGCGCCTTGTCAGAATGAGTAGGATTAAAACAGCCGCGGATTTCTCCACGCCCAAGATTCGTGACAGTTTTATGAAGAAGTTCATCGACAGTTCGAGCGTGGAAACTTCAATGGGCGTCGACGCCAGGCAGCAACTCGGCGAAACCGCGCAGTTGAGAAGACGGCGGACTGCAATCCCGTTGAAGCTGTTAAACTCGACCATATCCGAAGTGGATAAACTATCAAAGTTCGTGAGAAAGCAGTCGAGTATCACCGCGCTTATCAACGACTCCAATCGCCGAAGGACCTACGCGCTGCTTTCGCCGACCGAAACTTCCCCGAGGAACGCCACCGTTAACGTCGGCATTAACGTCGGCAACAAGCCGCAACCTGCTTCGGTTTTCCGATCTGCGTCGAGGCGTTTCCGAAGTCGCCCGCCACCGTCACCGAAGACACCTCAAGGTGACGTCAAACAAGTCATAAGAATGGCGAGCCAAGCGACAGGTCTTCACTCGCAGCTGAGCCAGGATGACAGTAATGGTAGAGATTTTGATATCCAGTGGGTGCGAGTCAAACGCGAAGAGGCTCAGCGCAAAAAGAAGGCTCAAGTAGAGAAGCTTCGCGAAAATCACCCCTACTTTGACCAGCCGCTTTTCTCGCTGCAGCGTGACTCGTGGTTCCGAAGGTTTCTACAGAGCATGGTAAACGCGCGTTACATAATTCCTCCAGGGTATACAGAACGGGCGTCACGCAATCACATTGTCACGATGGCACAACTTCACAAGTGCTTCGCCTCACAGACGTACCTGGAGTGGATCATGATCATTGTCACGATGATGTCTTGCATAGCTATGATGCTGGAGACTCCTACCCAGCGCACTTTTGACAGGCCTTCGACGGAAGTCATTGAGTATATCTTCGTTGTTGCTATGAGTTTGGAGCTTGGCCTGCGAATTCTTGCAAACGGGTTGATTTTCACACCCAATGCCGTTATTCAGAACTTTGGAGGTGCCCTGGACGTGACTATATACCTCGTGGCACTTGCCTATGTTGCCTGGCAACCACATCCGATCCCCGCGCGCTCGGGGGCTCAAGTGGTTGATGGTGTTAAGGTGCCTTCGTCCCTTGCGCATAGTCACATTGGTCCCGAAAATGCAAAAAGTGATCCTTGA

Transcript

OS493_008749-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IZF0	Sodium leak channel NALCN OS=Homo sapiens OX=9606 GN=NALCN PE=1 SV=1
Q8BXR5	Sodium leak channel NALCN OS=Mus musculus OX=10090 GN=Nalcn PE=1 SV=2
Q6Q760	Sodium leak channel NALCN OS=Rattus norvegicus OX=10116 GN=Nalcn PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007069 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR028823 all species →	Family	Sodium leak channel NALCN	Interproscan
IPR027359 all species →	Homologous_superfamily	Voltage-dependent channel domain superfamily	Interproscan
IPR005821 all species →	Domain	Ion transport domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46141 all species →	SODIUM LEAK CHANNEL NON-SELECTIVE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005261 all species →	Molecular Function	monoatomic cation channel activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0032224 all species →	Biological Process	positive regulation of synaptic transmission, cholinergic	Interproscan
GO:0032230 all species →	Biological Process	positive regulation of synaptic transmission, GABAergic	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008749-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008749-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

7.6Max TPM

3.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.35	6.39
polyp at pH7 6	18	18	3.44	6.13
coral polyp · control treatment	16	16	4.46	7.62
coral polyp · oil and dispersant treatment	16	16	3.76	6.66
coral polyp · oil treatment	16	16	3.79	7.11
coral polyp · dispersant treatment	16	16	2.21	5.30
Polyp	10	10	1.01	3.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.39
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.29
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.25
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.99
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.30
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.12
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.03
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.63
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.26
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.35
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.23
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.15
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.06
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.79
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.56
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.52
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.38
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.57
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.10
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.93
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.70
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.11
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.89
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.76
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.11
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.91
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.39
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.62
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.55
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.83
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.82
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.76
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.95
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.72
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.65
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.26
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.63
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.24
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.66
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.90
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.63
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.39
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.15
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.11
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.22
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.70
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.75
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.42
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.27
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.81
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.01
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.40
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.48
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.34
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.30
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.80
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.22
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.02
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.75
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.33
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.77
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.97
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.09
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.18
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.99
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.90
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.86
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.68
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.57
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.55
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.50
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.38

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.