Gene detail

Detailed information of OS493_008760-T1 in Lophelia pertusa

Genomic Location: scaffold_20:3825936...3850889
NR annotation: KAJ7386611.1, hypothetical protein OS493_008760 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008760-T1

ATGGCTGGTGTGTCTCAAGCTCCTCCATTTCCTCCACCCGAAGATCAAGACCAGAAGAACATCATTGACAAACTTGCAAACTTTGTTGCCAGAAATGGCACCAAATTTGAGGAGATGACCAAAATGAAACAGAAAGGAAATCCAAAGTTTGCATTTTTGTTTAGTGGGGAGTTCTACAACTACTACAGATGGAAAGTTTCATTTGAAATTGCAAACCAACAAACTCAACAGCATCTACAAAACCAGCAACAACTAGTGCAGCAAGTTGCAGCGCAATATGGCACAAACCCTCAAGCACATCTAGTGCAACAGGCAATTGTTCAGCAATCCATCAACTCTGCACCATGGCAACAAGCGCAGCAACAGGCACAGCAACAGATGCAAGCTCTTCAACAACAGGCACAAGCTACTGCAGCTGTTCCTATCTACCAGCCTCCCCCTGCTGTCATCCAGCCACAACCCAGTGAGCTGGATGTCACCGAACTGGAAAACCTGTTGCACAAGATTATGGAGTCATGTACTAAAGATTCTATATCGCATGGAAAGAATTTCATCTTTACCAATGCCAAGACAACTGCACAATGCTATCAAATTTCTCAATATCTGCTCAAAAGAGCCCTTGGTCCTGGTATGCTGTTTCAACACAAACTTCACATAGTGTACCTCGTCAATGACATTCTTCACCACTGCCAAAGGAAAGGAGCACAAGACCTACAGAAAAATCTTGAAGACATTGTAGTGCCTTTGTTTTTTTGCACGCTGATTGGGGAGTCCCCAGAGAATCTGCAGAAAGTAACAAAGGTTTTAGGAATCTGGGAAAGCCATAACCTTTTTGAACCATCCCTCTTGCAGGAACTGAAAAACACAGAAGCTGGTCAGAGTAAAGTTGATGCAGCTAAAGAGCAAGTGTTTGGACAAGGTTATTATGTTGCACCAGAGCGTTATCAACAATATTATCAGCAGCCACAGGAAAAGCAACAGGTACCACAGGTAGACCAGCAACCTCAACAGGGGAGAGAAGATAATTCATCACAGCAGAAGGTAGAAGAGAGTTCCCCTGAAACAAGTGATGAGGCAAAAGAACCACCAAAAGATCCTGTTAAGAAGGAAATCAAAGAAGAAAATACTGAGCAGACACCAGCAGAGGAAGCTGAAAATAGGGAGGAGGCACCCATGCAGCAACCATATCAACCACCACATTATCAGCAACATCCTCCACCCTTTCCTCCTCATTATGGTGACCAGGGACCTCAGTACTATGGCCACGGTCCTCCACCATTTGCTCCTCATTTTCCTCCTCCGCCGTACATGCCAGATTTCAGCCGTCACCCCCCTCAAATGTTTGGTCATCCACCACCCCCGAACTTCCATGATGAACCTGGATACCATGGAAGACCACCACCGCCACCATTCCGTGGTCCACCTCAACAGTTTGACTACCAGCACCAGAGGTCAGAGTTTGAGCAGTATGAGGGTAGAGGACCGCCGCCAATGGTGAATGAGTACAATCATGGCAGATCAGAAGAAGAGGAAGGGTATGGCATGGAGGAATATGATATGCCTCCTGACCTGCCTATACCTGAACCTATGGTACCTTCAGCCATGTACTATGAACTTCCTGCTGGTCTCATGGCTCCATTAGTAGGGTTACAAGATGTGGACTACATGCCATTAGATCCGGTTGCTCTTCGTCTGCCTGCACCACAGCCACCAAGTGAAAGACTTCTGGCCGCAGTTGAAGCATTTTACAGTCCTCCGAGTCATGAGAGACCCAGGAACAGTGAAGGGTGGGAACAAAGTGGTTTATTTGAGTTTTACAAAGCAAAGCTAAAGTACATTAAAGATCGGGAGGAAGCAGAGAAACACAGAGTACAAGAATTCCCACCAAGCAGATCGAGATCGAGGTCTCGGTCCAGATCTCCCCCACGTTCACCTTCTCCTTCCCCGCGTCAGCGGCGGTCTCGTTCCAGATCTCCTCCCAAAAGACGACATCATTCTCGCTCTCGAAGCCGGTCCATCTCTCCGAGGAAAAGAAGGTCGCGCTCAAAATCCCGGTCACGCTCAAAGTCACGCTCAAAATCACGCTCAAAGTCACGATCGCGTTCAATCTCGCCAATGTTCAAGTCAAACAGAAGTCCTGATAGAAGTCCAACTCCTCCAAGTTTTCATCCATCATACACATCGAAGGTGCCTGAGCAAAGATTGGATGAAAGTAACGTGGGACATCAGATGCTGATGAAAATGGGATGGGAAGGAGCAGGCCTGGGTAGGACTAAGCAAGGAATCCAGGATCCGATATCAGGGGGGGAGGTTCGGGATAAGTTTGACAAGTTCAAGGGAGTAGGTGTGGATATGAAGGATCCGTTTGAAGCGTACAGGAAAAGTAAAAGCTACTCGTTTCTTGGTTCACGTATCGCCAAGTCCGAAGCAAAGGCCGCAGCAAAGGCAGCTGCAATAGCTGAAAGGAAAGAGCAGAAAGAAAGAAAGAGTGAAAAGTGA

Transcript

OS493_008760-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IWX8	Calcium homeostasis endoplasmic reticulum protein OS=Homo sapiens OX=9606 GN=CHERP PE=1 SV=3
Q8CGZ0	Calcium homeostasis endoplasmic reticulum protein OS=Mus musculus OX=10090 GN=Cherp PE=1 SV=1
Q8K4Z5	Splicing factor 3A subunit 1 OS=Mus musculus OX=10090 GN=Sf3a1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004389 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01585 all species →	G-patch	G-patch domain	Family	Interproscan
PF04818 all species →	CID	CID domain	Repeat	Interproscan
PF01805 all species →	Surp	Surp module	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000467 all species →	Domain	G-patch domain	Interproscan
IPR008942 all species →	Homologous_superfamily	ENTH/VHS	Interproscan
IPR006569 all species →	Domain	CID domain	Interproscan
IPR000061 all species →	Domain	SWAP/Surp	Interproscan
IPR035967 all species →	Homologous_superfamily	SWAP/Surp superfamily	Interproscan
IPR039037 all species →	Family	Calcium homeostasis endoplasmic reticulum protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12323 all species →	SR-RELATED CTD ASSOCIATED FACTOR 6	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0006874 all species →	Biological Process	intracellular calcium ion homeostasis	Interproscan
GO:0048471 all species →	Cellular Component	perinuclear region of cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12841	CHERP; calcium homeostasis endoplasmic reticulum protein	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008760-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

47.6Max TPM

19.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.25	24.37
polyp at pH7 6	18	18	18.45	28.15
coral polyp · control treatment	16	16	24.33	47.58
coral polyp · oil and dispersant treatment	16	16	19.05	46.53
coral polyp · oil treatment	16	16	20.55	30.89
coral polyp · dispersant treatment	16	16	18.12	43.44
Polyp	10	10	15.67	32.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.37
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.50
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.39
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.06
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.70
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.69
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.36
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.20
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.78
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.35
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.61
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.48
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.23
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.55
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.38
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.79
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.15
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.43
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.40
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.54
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.84
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.67
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.67
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.60
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.43
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.64
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.27
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.45
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.58
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.25
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.08
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.34
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.22
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.12
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.71
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.35
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.04
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.99
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.80
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.11
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.22
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.01
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.53
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.59
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.43
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.42
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.33
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.15
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.50
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.80
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.39
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.86
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.65
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.58
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.94
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.89
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.05
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.76
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.36
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.97
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.53
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.44
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.09
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.40
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.57
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.48
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.77
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.72
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.44
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.91
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.66
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.21
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.10
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.37
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.64
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.09
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.45
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.49
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	32.89
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	21.61
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.11
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.99
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.33
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.82
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.20
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.71
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.23

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.