Gene detail

Detailed information of OS493_008976-T1 in Lophelia pertusa

Genomic Location: scaffold_21:2321746...2336716
NR annotation: KAJ7380513.1, Neurobeachin-like protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_008976-T1

ATGGACTGCCTGACAGGTCTGACAGACAGCTTAAGAAAGAAAGACAGAGCTCACGAGGAAAGCTGTGAGAAGTTTGACGAGCAGATCACACGGCCATTCAAACAGCTTCAAGATTCACAACGAGAACATGTGAAGAGTTTACCCAAACAACAAGAACATCAGAAAAATAATGTGACTCGTCAATGGAAAGTGTTGAAGAGAATGCTCATGTCGGAACGATCCCCGTGGGGGAGAGGGTCACCAAGGGAATCGCATTGGAAACTCTCATCCACAGAGAACTTTCATCGCATGCGTATCAAGCTAACACAAAACTACTCATTTACGCCTCATACTGATGCCAGTCGCGCGCGTGATAACGCAGACACGCGTGATGCGCGCGAGTCTTCCGTGCCCGTGCGTGTCGCGAAAGAGGCTGTTGTGCAAAACGTCGATGAGGACTTTCTTGAAGTCGAGGATCCCGGGAGTCCAACTGGTAAAGAAAGGCAACGGGCGATTTCTGAAACAGAAAAATCAGTTTTGGGTGAAGTTTGTGAGCTTATAACACTCATGGATATTGTCCCGGGGAAGCTGGAGGTCACCACTACGCATGTCTACTTCTATGCGGATGAGACCGCTGGACGGGATTTTCAGTGGCCGTTGAGTGAGCTGAGAGAAGTTCACTTAAGACGACACAATCTTAGAAGGAGCGCTTTGGAGTTCTTTTTGATTGATCAGACAAATTACTTCTTGAACTTCAACAAGGAGACTCGCCACAAAGTGTACAGGAAGATTATGTCCCTTCGCCCTCGTAATCTGTACTACATCGGCGCCAGATCACCTGCAAACTTACTCAAGGCTTCAGGGCTCACAGACAAGTGGGTACACAGAGAGATATCCAATTTTGAGTACCTCATGCAGCTGAACACCATCGCTGGAAGAACCTACAACGACCTGAGTCAGTATCCAGTATTTCCTTGGGTCCTTGTGGACTATGACTCAGAGGAGTTACGTCTAGATGACCCTGCCGTGTACAGGGACCTTTCCAAGCCTGTTGGGGCGCTTAATCCAGAACGAGTCCAATCTTTACGAGAGAGATACGATACGTTTGTGGATCCTTGCGGAATAATCGCCAAATTTCATTACGGTTCACATTATTCCAGCTCAGCGGGAGTTCTTCATTACTTACTGCGCGTGGAGCTCTTCACCACACTTCACGTTAAACTGCAGAGCGGCAAGTTCGACTGCGCGGACAGACAGTTTCATAACATCCCTTCCTCTTGGGACTCAATGTACGCAAAAGGTGGCGATGTTAAAGAGCTTATTCCTGAGTTTTTCTACTTCCCTGATTTCTTGGTGAACTCCAACAGATTCGATCTCGGCCGACTTCAGCGAGGACCGACTGTTGATGACGTCATTCTCCCGCGCTGGGCGACCTCGCCTGAGGATTTCGTGTGCAAACACAGACAAGCGTTGGAATCTGATCACGTGTCCTCTCACCTGCATGAGTGGATTGACTTGATATTCGGCTACAAACAGAAGGGGCCTGCTGCTGAGGAGGCCTTGAATGTGTTTTACTACTGTACTTATGAAGGAGCTGTCGATCTTGACGCCATTACAGACCCGGATGAGCGAGAGGCCACTGAGGGCATGATCAACAACTTTGGCCAGACTCCCATCCAGCTCATCACTCAGCCGCATCCACAGCGCATGTCTGCTGAGGAAGCCGCTAAGTTTAAAGCAGCAAAGAGCGCGGGCACAAGCAGAACGCTAGAGAATGTGTTCGAGAATTTCGACAAGTTGAAAGCCTATTTTGTTACTGTATCTGATGCTACTGACCCGCTGGTATTCGCTGCAGTGTCTCAGGTGTACACCAGGTCACTGATTCATTCAGGCATGCCTGAGCACATGATCACTATTAGCCAAAATGGCATTGTGGGGCTGCAAGACTGGTTGCCTTACTCTAAGACCAGGACAAAACCTTTCACCTTCGAACTTGACCCTTCTTTGTCATCAAACAGATTACGCCGTTGTATCGCGGGCCCGTTTAGCCCTGACTTGCAGATTTCGTCACGCATGTTTACCATTACCCATGATGCTAAGTTAATCATAACCGCTGGCCACTGGGACAACAGTTTCAGAGTTTTTACTACAAAGGGAAAGCAGCTGACCAGAATTGTGGCTCATACAGACGTGATAACTTGCGTCTCATTGGATGACGATGGTCATCACCTGATCACCGGATCACGTGACACCACGAGCTGCCTGTGGGGAATCGCTCACCAGGGAGGGGTGGCTCAGGAGTTGAAGCGCACGCCTCTGCAGACCTTATATGGTCACGACAAACCAATCACGTGTGTTGCTATGAGTTGGGAGCTTGACATGGCGGTCAGCGGTTCTCAGGATGGAACATGTATTATTTACACAGCGCGTAAAGGGGAATACGTCATCACGCTAAGACCCATGGGAACGGCGCCCTGTACACGGACAAGCCCTTGTCACGTGACATGCCTGGCGCTGTCCGAATATGGTAACATTGTGGTATCGTGCAAGCAGGAATCGAACCGAGCCCTGTGTAGATACACCATCAATGGAAAACTTCTGTCAAAAGACGTTAAATTAAAAGAAGATGTTGTGGATGTTTTTATTTCTAGAGAATTTGTTGTTACTGGCGGTGTCAGTGGAAGACTTGAAATCAGAGAGTTGCACAGTTTCAGAGTGGTAAAGAAGATGAATCTTCGAGTTCCAATTCGTTATGTCTCGCTGGCGAGGGATAACACGCACATCTTCGTTTGTCTTCAAGATGGCAAGCTTATCGTCATTGGCGTAGAAGGCTCGTGA

Transcript

OS493_008976-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6ZS30	Neurobeachin-like protein 1 OS=Homo sapiens OX=9606 GN=NBEAL1 PE=1 SV=3
E7FAW3	Neurobeachin-like protein 2 OS=Danio rerio OX=7955 GN=nbeal2 PE=1 SV=1
Q6ZQA0	Neurobeachin-like protein 2 OS=Mus musculus OX=10090 GN=Nbeal2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002886 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14844 all species →	PH_BEACH	PH domain associated with Beige/BEACH	Domain	Interproscan
PF16057 all species →	DUF4800	Domain of unknown function (DUF4800)	Family	Interproscan
PF02138 all species →	Beach	Beige/BEACH domain	Family	Interproscan
PF20426 all species →	NBCH_WD40	Neurobeachin beta propeller domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036372 all species →	Homologous_superfamily	BEACH domain superfamily	Interproscan
IPR000409 all species →	Domain	BEACH domain	Interproscan
IPR023362 all species →	Domain	PH-BEACH domain	Interproscan
IPR050865 all species →	Family	BEACH Domain-Containing	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR046851 all species →	Domain	Neurobeachin, beta-propeller domain	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13743 all species →	BEIGE/BEACH-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0008104 all species →	Biological Process	protein localization	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0019901 all species →	Molecular Function	protein kinase binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_008976-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_008976-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

37.5Max TPM

19.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.20	37.15
polyp at pH7 6	18	18	18.54	32.14
coral polyp · control treatment	16	16	24.06	37.52
coral polyp · oil and dispersant treatment	16	16	18.74	32.29
coral polyp · oil treatment	16	16	24.64	36.09
coral polyp · dispersant treatment	16	16	15.01	24.87
Polyp	10	10	13.37	30.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.13
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.35
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.51
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.42
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.97
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.38
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.28
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.25
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.61
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.36
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.88
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.51
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.14
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.23
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.45
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.36
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.85
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.20
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.05
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.23
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.02
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.16
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.88
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.20
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.11
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.50
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.52
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.93
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.59
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.36
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.01
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.82
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.76
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.64
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.89
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.38
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.06
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.32
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.08
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.60
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.10
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.43
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.94
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.69
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.25
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.50
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.08
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.99
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.10
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.98
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.23
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.09
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.56
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.24
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.09
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.31
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.59
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.50
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.65
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.57
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.36
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.55
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.88
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.50
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.16
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.95
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.14
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.55
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.87
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.06
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.94
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.64
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.91
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.56
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.58
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.28
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.02
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.01
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.45
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.72
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.72
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.32
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	30.52
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	24.72
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.70
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	17.36
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.79
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.13
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.79
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.