Gene detail

Detailed information of OS493_009081-T1 in Lophelia pertusa

Genomic Location: scaffold_21:3470690...3480797
NR annotation: KAJ7380614.1, hypothetical protein OS493_009081 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009081-T1

ATGAACAACGATTTGAGATCCGTCTTAGGCAATCTGTCAAGGGAAATCGACGTCGCGAATTCCCTCCTTCAAAATCAGGATTCAAGCGGTAGCCCCTCTTTAGCTAACGCACTTGGAAATGCTCGCGATACAGTGAGATCTCTTCAGTCGGACTCGACACTAAGAAACAACATATCACGTTCCTTCACCCGCTCACCCTCAGCTTCCACCAGCGGTTCCACTAACCGCACAACGCTTCCATCAGTGGCACGGGGTCCGGGACCTTCGCATCGCTTTAATTCTTCCCGTCAGTCGACTGTCCCGTACGGGCGTCGACCTCGAGCAAGAGAACCGCGTCGTTATGACATGAAACTCCTTGTAGTTGATTTCATTCCAGAACTTTTTGCCGCTTCTTCGAAAGGAAACATTTCCAATTATCGCGGCGACGCAGTTATCGAAACGCCGTTCTTTATAATGGAGGACCAGACAGCAGTTGCGGTGAAAAATAAGGTGATGGCAGTAATCAAAAACCAATATGATGATTATGGAGGGCAATTTGTCTTCGCATCTCGAAGAAATAGGAATTTTCTCTCGATTGCTGGTGAACAGGACTTAGATGCGAGGGGTGTTCACACCCTGAAGGGATCTGGATGCGTGTATGTTGTCTTGGATACTCCTGTTGGACCTACTGACGAAGAGGGTTTTCAAGAGGAAGATCCGACTACGGAAACCATTCAGCCAGTTCCAGTATCTGCTAGGGTTTCAGAAGAGAGGAGTAGACAGTTTAGGCAGGAAACATTAAGGTCCTTGCTTGACCATAATGCAAGCTCAAATACTGATGTCAGGGAAACAGTTCCGGTAGTGGACGACTCTGTTCCGACATCTATGTTTTTCGTTGGACACAATGAGGATATTCATTTGAAGGATTCAGGTTTGAAAGAAACAGGATTTATGAACCCAGATAAGCGTAAAAGCAGCTTGATCTCGGTGTTGGCTATTTTACAATGGATAAAACCTTTTATGACGCTTGTATCTAGAGGAGGCAGTGAGTTTTTGACTAGCATACTTAAGTGTTATGGCGTTAGAGGCATCGCAGATTTCCGAGTAAACGAAATTTTGGATTCTCTTACCTCCTTGGGGATATCTGCTGAAAGCAGAAGTGTAATGATGGATCCAAACTACGTTTTGCAAAGGATGCTGCAGATAATTTTTGAAACTGAAGAGGAAAAAGGTACACTTACATCAATTTTTGGAGGGAAAATGGCCATCAGGACAACTCTCAATAGTTCGCAGTCTGAAGAAATCATTTTCGAAGAAGACAATCAAGAGTCTTCAAGCCCTGCTATGATGTTCAACCTGAAAATGCCCAGAGAAAGCAGCTCCACTGTCACGCCACCTCGCTTGCGCGACCTTTTGAATGAAAGCCTGAAACATGGCCAACCTATTCCCTTCTCCAGTTGGAAAGATGCATGGAAGGAGAAATATTCAGGTCAAAACACTGCTGAAGGTAGTGAATCAGATCCATGTGCCATAAATTATCAAACCTGGACGGACTGTCCCGACTGTTTGATTGTGGGCTTAAACAGAGCCTCAAAACAAAGAAGCTGGAATACCAAACTTGTATCGCTTGATAGCAACATACCAGTGGCTGATCTTCTAAAACCCGAGGATGAGACACTTCATAGCATCAACGATCTGAGCGAGTCGTACAAGTTATTTGGTTTGATTGTGAAATCAGAGGGCGATCGAGTGTATGCTTGTGTAAAAACAGAAGCGGAAAGCGATAAATGCTTCTATGTAAGGTCATGGAGTGCCATCAAGAAGCCCGGCGTTCCTCCCGCAGATACACGAGACGAAATATTGAAAAGTATTGGGAACGACGAAGACTGCATTATCATCCAAGACACAGTGCAACACGAAGCAGTGTTACACCGGATGGAGAAGGCCATGAATGGCTTTATCGGCCTAGACTCTCTCAAGGAGCAGTTTCTACGGTTCACAAGGACACAATTGCAAAATGATAGGAGGAAACGTCTTGGCCGGAGAATACGTGAAGACACCCCTCTCCATCTGGTGTTTGCTGGAAACCCAGGAACTGGGAAGACAACGTTTGCACGTCGTGTTGCAGAAGTTCAAAGGTCCGCACTTGTTGGCCAGTACCTTGGCTCTACAACCGAAAAGACCAAGGGGGTGATCAAGGAAGCACGTGGCGGAGTTCTGTTTGTCGACGAGGCATATCGTCTGATCCCCACTGCTGGCGGAAAAGACTTTGGCCGCGAAGCCATAGAAGAAACTGATGGCGGTTACGAAAGGCAGATGGAGAAGTTTTTAGACGTTAATCCAGGACTTAGATCGCGGATCTACAGGAGGTTTGTCTTTCCCGATTACACCCCCGCTGAACTTGGGGAAATATTTTACATGAAGGCAAGGGAGAAAGGGTTTTCCATCAATGATGATGTTGATGTGTCCAGCATTCTATCCGTTCACACTACCCCTGAACAAAGAAAGAACATGAACGCGCGCCTCGTACGAATTTTGCTGCAAGAATCAATCGAAGAATCGAGTAATCGGGTGCCACTAAATGCCCCGTTAGATCAGCTGATGGAGATAAAGGAAAGTGACATCGTTGCGGCCTGTTCGAGTTTGCCGTCTTATTCAGTAGACGAAGGTGACTAA

Transcript

OS493_009081-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P27643	Stage V sporulation protein K OS=Bacillus subtilis (strain 168) OX=224308 GN=spoVK PE=2 SV=3
P9WPI2	ESX-3 secretion system protein EccA3 OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=eccA3 PE=3 SV=1
P9WPI3	ESX-3 secretion system protein EccA3 OS=Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) OX=83332 GN=eccA3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001687 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR000641 all species →	Family	CbxX/CfxQ	Interproscan
IPR050773 all species →	Family	CbxX/CfxQ RuBisCO activation and ESX secretion	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43392 all species →	AAA-TYPE ATPASE FAMILY PROTEIN / ANKYRIN REPEAT FAMILY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009081-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009081-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

69TPM > 0

7Conditions

3.4Max TPM

0.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	6	0.11	0.60
polyp at pH7 6	18	7	0.16	0.70
coral polyp · control treatment	16	13	0.29	1.08
coral polyp · oil and dispersant treatment	16	14	0.36	2.74
coral polyp · oil treatment	16	12	0.58	3.37
coral polyp · dispersant treatment	16	14	0.23	0.96
Polyp	10	3	0.04	0.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.60
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.55
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.24
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.12
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.11
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.70
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.56
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.47
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.34
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.30
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.05
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.08
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.72
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.65
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.20
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.10
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.07
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.07
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.05
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.03
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.74
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.37
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.29
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.12
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.08
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.08
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.05
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.04
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.04
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.02
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.37
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.65
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.18
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.12
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.09
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.08
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.06
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.96
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.69
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.27
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.15
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.11
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.08
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.07
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.05
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.02
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.23
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.04
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.