Gene detail

Detailed information of OS493_009102-T1 in Lophelia pertusa

Genomic Location: scaffold_22:141381...153380
NR annotation: KAJ7373780.1, Acetyl-coenzyme A synthetase, cytoplasmic [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009102-T1

ATGGCATCTACAGACTCTAAAGAACACGAGAAGCAGCTAGAGGGTTGGTTTTACCCCTCAGAGGAGATCAAATCTGAGGCGTATGTGTCAAGTATGGATCGATACAAAGAGCTGTATCAAAAATCCATTGATGATCCGGCTGGCTTCTGGGGAGACATTGCAAACGAATTCTACTGGAAGGTCCCGCCAAGCAAAGAGAAGTTCATGCAATTCAACTTTGACACTCGCGAGGGAAAAGTATTTATCAAATGGATGGAAGGAGCTGTCACAAACATTTCATACAACCTATTGGACAGAAATGTGGAAAAAGGACTTGGTGATAATGTAGCATTTTATTGGGAGGGAAATTTTCCTGGAGACAGCAAGCAGATAACTTACAGTGAACTTCTCTCAGAAGTATGCAAGTTTTCTAATGTGTTGAAAGATAAAGGTATCAAGAAAGGTGACAGGGTGGCAATTTATATGCCAATGATTAATGAGTTAGTAGTTGCCATGTTGGCTTGTGCAAGAATTGGAGCTGTTCACTCAATTGTGTTTGGTGGCTTCTCTGCAGAATCTTTGGCTGAACGTATACTTGACTCAACTTGTAAAGTTCTTGTCACTGCTGATGGGTCATATAGAGGCGCAAAGCTTATTGACTTAAAGGAAATTTCTGATGAAGCCATAGGAAAGTGCAAAGATCAAGGATTTACAGTAGAAACTTGTATTGTTGTTCAGCATGTGGGCGGCGGCTCAGGGAATGGTACTGTTAGTCCACGAACATCACCGGTGGCCAAGAAACCATGCCCACCAATACAGACAAATTTTAATAGTGCTGTTGACTGTTGGTGGCATGAACTGATGTCATGTGCAAGTGATAAATGTGAGCCATGTTGGACAGATGCTGAGGATCCATTATTCATGCTTTATACTAGTGGATCAACTGGCAAGCCAAAAGGTGTCCTTCACACTGTTGGAGGCTACATGCTTTTTACTGCTGTTACCTTTAAGTATGTGTTTGACTATCATCCTGGGGAGGTGTACTGGTGCACTGCAGATATTGGCTGGATCACTGGTCACAGTTACATCACTTATGGCCCATTAGCAAATGGTGCAACAAGTGTGCTGTTTGAGGGTACTCCTTTCTACCCTGATTCTGGTCGCTTCTGGGGTGTAGTTGACAAGTACCATGTTTCAAAGTTCTACACAGCTCCGACAGCTATTAGAGCTCTGATGAAGTTTGGAAAAGCTGTTGTTCAAAAGTACAACCGTAAGTCGCTGAAAGTACTTGGAACAGTGGGTGAACCTATTAACCCTGAAGCATGGCTATGGTATTATCGCACAGTGGGTGATGAGAGATGTGTAATCGTTGATACATACTGGCAGACAGAGACTGGTGGACATGTTATCACATCACTCCCTGGAGCAACACCCATGAGGCCAGGAGCAGCATCGTTCCCTTTCTTTGGAGTTGTGCCAGCCATTGTTGATGAACATGGAAAGGAGCTTGAAGGAGCCTGTGAGGGATTTCTGGTGATGAAGCAACCTTGGCCAGGCATGGCTAGAACAATCTATGGAAATCATGAGCGATTTGAACGTGTTTACTTCTCGAAGTTCAATGGTTACTACACCACAGGAGATGGTTGTAAGCGTGATAGTAATGGTTATTACTGGATCACTGGTAGAACAGATGACTGCATGAATGTTTCTGGTCACCTGTTGAGTACAGCACAAATTGAAAGTGCTTTGGTGGAACATGATGCAGTAACTGAAGCTGCTGTTGTGTCCTGTCCTCACAAAGAAAAAGGAGAAGGGATCTACTGTTTCACCACTCTGATGGAGGGAGTGGAATTTAATGAACAACTCATCAAAGAACTCAAACAAAAAGTTCGCTCCAAAATTGGACCCTTTGCAACCCCTGATGTCATCCAAAATTCACCTGGGCTTCCAAAGACACGCTCAGGCAAGATCATGCGCCGAGTGCTGAGGCAGGTTGCAAAGAATGACAAGAAAATCGGTGATGTGACAACCATGGCTGACTCTTCTGTTGTCGACAACTTGTTTCATAACAGGCCTCATGTGGATTTCATTCAAGAGTAA

Transcript

OS493_009102-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9QXG4	Acetyl-coenzyme A synthetase, cytoplasmic OS=Mus musculus OX=10090 GN=Acss2 PE=1 SV=2
Q9NR19	Acetyl-coenzyme A synthetase, cytoplasmic OS=Homo sapiens OX=9606 GN=ACSS2 PE=1 SV=1
Q9VP61	Acetyl-coenzyme A synthetase OS=Drosophila melanogaster OX=7227 GN=AcCoAS PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000999 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16177 all species →	ACAS_N	Acetyl-coenzyme A synthetase N-terminus	Family	Interproscan
PF13193 all species →	AMP-binding_C	AMP-binding enzyme C-terminal domain	Domain	Interproscan
PF00501 all species →	AMP-binding	AMP-binding enzyme	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032387 all species →	Domain	Acetyl-coenzyme A synthetase, N-terminal domain	Interproscan
IPR025110 all species →	Domain	AMP-binding enzyme, C-terminal domain	Interproscan
IPR042099 all species →	Homologous_superfamily	ANL, N-terminal domain	Interproscan
IPR000873 all species →	Domain	AMP-dependent synthetase/ligase domain	Interproscan
IPR020845 all species →	Conserved_site	AMP-binding, conserved site	Interproscan
IPR045851 all species →	Homologous_superfamily	AMP-binding enzyme, C-terminal domain superfamily	Interproscan
IPR011904 all species →	Family	Acetate-CoA ligase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24095 all species →	ACETYL-COENZYME A SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003987 all species →	Molecular Function	acetate-CoA ligase activity	Interproscan
GO:0006085 all species →	Biological Process	acetyl-CoA biosynthetic process	Interproscan
GO:0016208 all species →	Molecular Function	AMP binding	Interproscan
GO:0019427 all species →	Biological Process	acetyl-CoA biosynthetic process from acetate	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01895	ACSS1_2, acs; acetyl-CoA synthetase	EC:6.2.1.1	Lipid biosynthesis proteins	ko01004	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009102-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

120.1Max TPM

65.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	78.90	97.11
polyp at pH7 6	18	18	78.79	112.30
coral polyp · control treatment	16	16	68.17	114.57
coral polyp · oil and dispersant treatment	16	16	47.74	103.61
coral polyp · oil treatment	16	16	70.53	120.13
coral polyp · dispersant treatment	16	16	47.81	90.73
Polyp	10	10	62.20	97.12

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	97.11
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	96.58
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	94.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	92.99
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.15
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	90.94
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	86.13
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	86.09
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	84.62
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	80.27
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	79.35
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	77.64
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.01
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.98
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.65
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	61.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.21
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.64
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	112.30
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	106.86
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	98.16
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	95.70
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	92.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	89.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	85.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	84.16
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	82.82
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	82.45
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	75.54
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	71.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.04
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.27
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.42
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.86
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	114.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	104.95
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	94.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.15
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.93
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	77.26
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.98
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.88
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.60
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.16
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.97
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.08
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.33
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.24
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.30
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	103.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.46
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	88.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.66
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.17
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.75
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.55
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.37
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.40
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.35
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.02
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	120.13
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	119.61
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	111.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	98.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	97.49
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	82.47
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	77.43
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.59
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.58
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.91
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.39
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.29
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.34
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	90.73
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	80.96
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.72
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.80
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.67
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.28
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.17
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.03
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.86
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.55
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	97.12
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	84.40
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	70.02
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	69.44
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	64.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	60.12
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	57.94
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	46.75
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	44.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	26.77

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.