Gene detail

Detailed information of OS493_009214-T1 in Lophelia pertusa

Genomic Location: scaffold_22:942843...960847
NR annotation: KAJ7373890.1, ATP-dependent RNA helicase dhx29 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009214-T1

ATGATGTGTCTTATAACCATTGCCAGGAAAACAAAAAAGGCAGAAAGTGAACTTAAGCAGCGTGCGTATGTTACAATGGACAGCCATCGCGAGGAGAGAATAAGTCAGCTGTTGGGAGAAATGAGAGGAAATGAACATAGCAGAAATAATGACAGAGCACAGGCTGGTGCGTCAAGTGCGCCAGGTGCATCAGGTGCGTCAGGTGCGTCAGGTGCGTCAGGTGCGTCAGGTGCGTCAGGTGCGTCAGGTGCGTCAGGTGCATCAGGTGCGTCAGGTGCGTCAGCCTGTAGAGATTGGTATGATGCTCCTTATGAAGACAATGAACAGCGTGAAGGAGGATCATACCTGTACAACAGGGATCAACCTGAAGCAGGGTCATACAGCAGGGATACAGATATGCAAGGGGAATTTGGAGATCAGTTTGCAGCCAAAACAGCTGAGGATGTTTACATCCCAGATGAGGAGGATAACAGAATAAATCAGCCAACTTCTAAGTACTCTTCTCATGTGCACAAACATTTAAACCAGGACATTGATTTGGATAAAAAATTAACGGAAGGACAACAGACAAAGGTGAAGTCTGGCAGTGCAAGATATAGAACCATGCAGGAATTCCGTAAAAAATTACCAGCTTATGAGCAAAAAGAGGAATTACTTCAACTCATTAACTCTGAACAGGTGTTAGTTATCAGTGGAGAGACTGGATGCGGCAAAACAACGCAGGTTGCACAGTTTATCTTGGATGACGCCATTGCACGAGGCTGTGGATCAACATGTAGAGTGATGTGCACACAACCCAGGAGGATCAGTGCTATTTCTGTGGCAGAGAGAGTTGCAGCGGAGAGAGATGAAAAATGTGGTGAAAACGGTAGTGTTGGATTTCAGATCAGATTGGAAAGCAAGCTACCTCGGAAACAGGGCTCCATTCTCTATTGTACAACAGGAGTGCTTCTTAGATGGCTTGTTTCTGATCCATTACTTCTTGGTACGAGTCACATCATTCTTGATGAAATTCATGAAAGAGATATTTTATCAGATTTTCTGATTATTATTCTCAAAGATCTTTTACCAAAAAGGCCTGACTTGAAACTGATACTTATGAGTGCAACATTGAATTCAGAGATGTTCTCTGCCTATTTTGGTAATTGTAAAATGTCTCACATTCCTGGCTTCACCTTCCCTGTCCAAGAGCTTTACCTTGAGGAAATCATTGAAAAAACAGGGTATGAAGTTAAAGAAAAAGCTGTTGGCTTTGGCAGAAAACAACCAAGATGGAAACAACATAAAAGAACTAAGAGCAGTGCAAAAGACAGAAGGTTGGAAAAGTCCAATGCTTGGCTGATGGAAAGTCAGTGGGATGACAATGAGATGGAATGGCAGCAGTATCTTCACTCAATCAGAGGAAGATTTTCACCCAAAACGATCACGACACTTCAGAACATGGACCTGGAAAAGATTGACTTTCAACTTCTGGTTCGAGTGATTACACACATCTCACTTCGCATGGAGGAAGGAGCTATTCTTGTTTTTCTGCCTGGTTGGGATGATATCAGCAAACTTCACGACAACTTGAAAAAGCAAACGCTTTTCTCTTTGACAGACAAATTCTGCATCATTCCTTTGCATTCTATGATGCCATCAGCGAAGCAACATGAGGTTTTTGACCGTCCACCAAAAGGTGTCAGAAAGATAGTGATCGCCACTAACATCGCTGAAACGAGTATCACTATTGATGATGTTGTATTTGTTGTGGATGCTGGTAAAGCGAAACAAAAGACGTATGATGTGAACAACAAATTTCCTGTTTACAATCGGAATGGATCAGCAAGGCCTCCTCGCTGCAAAGACGAGGCCGAGCTGGAAGAGTTCAGCCTGGGTACTGCTTTCACTTGTTCTCCCAACCTCGCCTTAGAGCCTCCTGAGGGGCAAGCGGTCAGCAATGCTTTAGAAGTTCTTCATCAACTTAATGCACTGGACGGGAATGAACAACTGACTCCACTTGGCTATCACCTGGCGTCCTTACCAATCAACCCGCGCGTGGGAAAGATGATATTATTTGGTGCAATGTTCTCATGTTTGGACCCTGTGTTGACTGTGGCATCTATTTTAGGATTCAGGGATCCCTTTGTGATTCCACTGGGAAAACAGAAGGAAGCTGATCAAGCTCGTACCAGGTTTGCCGGTGATACACGCAGTGACCATTTAGCTGTCTTGAAAGCTTTCCAGGGCTGGGAGAGTTCTGCTCGGCATGGAAATGACAGAGACTTCTGTTGGAGAAACTTCCTGTCTGTGAACACGATGAAGATGATAAAAGATATGAAGCAACAGTTTGCCGGACTGCTGTATCAAATCGGTTTCCTAGATACCTCTCATCCCAAGAATTCTGCCGCTAATTACAATTCAGATAATTTGAAACTTGTTAAAGCCATCCTGTGTGCGGGGCTGTATCCAAATGTTGCTAAAATAAATCACCATCCGGGACTTAAAAGGCCTCCAAAGCTTCAGACACAACAGGATGGCAGAGTCTCTCTTCATCCTAAATCTGTGAATGCTGAAGTGACAGTTTTTGAGGACAACTGGCTGATTTATCACGAAAAGATGAAATCATCCTCGTTATTCCTGTACGACAGCACCATGATCGCGCCTTTTCCTCTGCTGTTCTTTGGCGGCCAGATTTCTGTGTTTGTCGAAGATGGCTACGAAACTGTTGCAGTCGACGATTTCATTAAATTTAAATCCCCTACAAGAATCGCTAACTTGGTCAAGGAGTTACGAGTTGAGCTCGACAAACTGCTGAGACAGAAAATAGCACAGCCAGAGATGAAGCTGAGCGTGGGGACTGGGACAGGTAGCAAGGAAAGTGCTCTGCTGCGGGCCATCATTGATCTGATCACCAGCGAAGAGAATACAAACTGGAAAAAGCAAAGAGCACGTGCCAGTGAATCCAAAGGGAGTTGA

Transcript

OS493_009214-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9H2U1	ATP-dependent DNA/RNA helicase DHX36 OS=Homo sapiens OX=9606 GN=DHX36 PE=1 SV=2
Q05B79	ATP-dependent DNA/RNA helicase DHX36 OS=Bos taurus OX=9913 GN=DHX36 PE=1 SV=1
Q8VHK9	ATP-dependent DNA/RNA helicase DHX36 OS=Mus musculus OX=10090 GN=Dhx36 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000674 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04408 all species →	HA2_N	Helicase associated domain (HA2), winged-helix	Domain	Interproscan
PF07717 all species →	OB_NTP_bind	Oligonucleotide/oligosaccharide-binding (OB)-fold	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF21010 all species →	HA2_C	Helicase associated domain (HA2), ratchet-like	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR002464 all species →	Conserved_site	DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site	Interproscan
IPR048333 all species →	Domain	Helicase associated domain (HA2), winged-helix domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR011709 all species →	Domain	DEAD-box helicase, OB fold	Interproscan
IPR007502 all species →	Domain	Helicase-associated domain	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18934 all species →	ATP-DEPENDENT RNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0002151 all species →	Molecular Function	G-quadruplex RNA binding	Interproscan
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003724 all species →	Molecular Function	RNA helicase activity	Interproscan
GO:0004386 all species →	Molecular Function	helicase activity	Interproscan
GO:0005622 all species →	Cellular Component	intracellular anatomical structure	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14442	DHX36, RHAU; ATP-dependent RNA helicase DHX36	EC:5.6.2.6	Translation factors	ko03012	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009214-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

25.1Max TPM

10.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.45	13.70
polyp at pH7 6	18	18	11.69	19.90
coral polyp · control treatment	16	16	12.27	24.40
coral polyp · oil and dispersant treatment	16	16	7.25	13.97
coral polyp · oil treatment	16	16	11.82	20.96
coral polyp · dispersant treatment	16	16	6.72	10.37
Polyp	10	10	10.01	25.07

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.70
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.78
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.68
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.24
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.95
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.85
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.65
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.65
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.50
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.42
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.39
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.05
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.64
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.21
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.72
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.90
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.80
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.91
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.56
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.84
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.51
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.47
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.41
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.35
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.79
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.32
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.67
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.55
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.80
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.92
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.10
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.71
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.57
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.74
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.42
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.96
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.10
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.08
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.51
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.51
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.96
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.76
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.63
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.33
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.27
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.63
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.61
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.72
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.78
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.10
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.45
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.96
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.77
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.22
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.76
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.02
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.09
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.62
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.73
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.37
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.31
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.16
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.58
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.68
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.90
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.62
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.37
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.25
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.93
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.86
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.21
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.28
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.95
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.07
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	14.97
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.56
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.16
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.95
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.50
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.49

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.