Gene detail

Detailed information of OS493_009280-T1 in Lophelia pertusa

Genomic Location: scaffold_22:1478609...1488820
NR annotation: KAJ7373953.1, hypothetical protein OS493_009280 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009280-T1

ATGCTGAACTATAATCCTGAGACGGTCAGTACAGATTACGATGAGTGTGAAAGGCTGTACTTTGATGAAATCTCATTTGAGATCGTCATGGATGTGTATGAGAAGGAGAATCCGGAAGGTATTATCCTGAGCATGGGCGGACAATTACCAAACAACATAGCCATGCATCTTCACAGACAACAGGTTCGCATTCTTGGCACATCGCCTGAGATGATTGACAATGCAGAGAATAGATTCAAATTTTCCAGGATGTTGGACAATATTGGAATTCTGCAGCCGCGATGGAAGGTTCTAACAACTCTTGAGGATGCCAAGAAGTTTAGTGCCACTGTAGGTTACCCTTGCCTTGTGCGACCTTCCTACGTGCTCAGTGGTGCTGCTATGAATGTCGCACATTCTGATCAGGACTTGGTTACATATCTCGGAAATGCCATGTCGTTATCCAGTGATCACCCAGTTGTCATCTCTAAATTCATCCAGGATGCTAAGGAGATAGATGTTGACGCAGTAGCTTGTGATGGTGAGGTGGTTATCATGGCAGTCTCTGAGCATGTGGAGAATGCTGGAGTCCATTCTGGTGATGCCACTATGGTCCTTCCTCCACAAGATCTGAATGACGAGACGCTCAAGAAAATACGCAAGATCTGCTTCGATATTGGACAGGCCTTAATGGTGACTGGGCCTTTCAACATGCAGTTGATTGCCAAGGATAATGAACTAAAAGTGATTGAGTGCAATCTCCGTGTGTCCCGCTCGTTCCCATTCGTGTCCAAGACTCTTGATCACGACTTTGTTGCTCTGGCAACGAGAGTCATTTGTGGCGTGTCAGTAGAACCAGCTCTGGATTGTTGTACTGGGTGCGGGCGAGTTGGAGTTAAGGTCCCGCAATTTTCATTTTCACGTTTGGCTGGAGCAGATGCTATGTTAGGAGTGGAGATGTCTAGTACAGGAGAAGTGGCCTGTTTTGGTGAGGACCGATATGAAGCTTACCTCAAGGGCATGCTTAGTACTGGCTTTAAGATTCCTCAAGACTGCATCCTGCTCTCGATTGGCAGCTTCAAGTCCAAGAACGAGATGCTACCCAGTGTGAAAACATTACAAGAGTTAGGATTCCAGTTATACGCCAGTCTTGGTACAGCGGATTTCTACTCAGAACATGGCATCGAGGTTAAACCAGTGGATTGGCCATTTGAGGAGGGCGGTAATGGAGCCACAGAGCTAAGCATACTTGACTATCTTGTGCAGAACAAGTTTGACATGGTGATCAACCTTCCCTTGAGGAACACAGGATCCAGAAGGGCTTCTTCGTTTATAACACATGGTTACCGCACCCGCAGAATGGCAATCGATTATTCCATCCCGCTCATTACTGACATCAAGTGTGCTAAGTTGTTTATTGAGGCCCTGAAGAGAGTTGGTGGAGCGCCTAAAGTCAAGACACACATTGACTGCATGTCGTCAGGTCGTGTCGTGCGTCTGCCAGGTCTGATTGACGTCCATGTGCACATGCGCGAACCTGGTGCCACTCACAAGGAAGATTTCTCATCCGGGACAGCAGCCGCCCTTGCTGGCGGCGTGACACTGGTGCTAGCTATGCCAAACACTAATCCTGCTATAGTCGACGAATCAGCGTTTAATCTGGTTAGAAAGTTGGCCTCTGCTGGTGCGCGGTGTGATTATGGATTGTACGTGGGCGCCAGTGCTGACAATTACTCAACAGTGAAGGAGTTAGCTCACTTGTCAGCTGGGCTGAAAATGTATCTCAATGAGACCTTTACAACGCTTAGACTTGATGACATGTCAACATGGATGAAGCATCTTGAGCAGTGGCCTAAACACATGCCTCTTGTGTGTCATGCTGAGGGACGTACCACTGCTGCTATCTTACTGTTGGCGGAGTTAGCTGATAGACCTGTGCTTGTGATTCGTGCTGCTAAAGAGAAAGGAATCCAAGTGACGTGTGAAGTATCGCCGCATCACTTGTTCCTAACCGAGGATGACGCGGACAGGATCGGCATCAAGAGGTCTGGGGTCAAGCCTCCGCTCGTCACAGCTGAGGATCAGAAAGCACTCTGGGATAATATTGACATCATCGACTGCTTTGCTACTGATCATGCACCACACACGCTGGAAGAAAAAGATTCTGAGAAACCACCGCCTGGATTTCCTGGCCTGGAAACCATGCTTCCTATGCTTTTGACTGCCGTGCACCAGGGACGATTAACGATCGATGATATCATCCTTCGTTTATGCACAAATCCACGGAAAATCTTCAGCCTTCCTGAGCAGAAAGACACATACGTGGAAGTGGAAATTGGCGAAGAATGGACCATCCCGCCAGCCATGACTTACTCCAAAGCACAATGGACGCCATTCACTGGAATGAAGGTCAACGGCTGCGTCAGAAGAGTTGTACTGAGAGGCGAAACTGCTGTCATAGACGGCAAGGTCCTGGCAGCACCTGGATCAGGTCAGGATGTACGAGTGATCAGCGCGGTGTTACCACCACCCCCGGTCTACCAGCCACCACCCTGGTCCCACCCCCAAGTCCGAGGAAGCTAG

Transcript

OS493_009280-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q91437	Multifunctional protein CAD OS=Squalus acanthias OX=7797 GN=CAD PE=2 SV=1
P05990	Multifunctional protein r OS=Drosophila melanogaster OX=7227 GN=r PE=1 SV=3
P08955	Multifunctional protein CAD OS=Mesocricetus auratus OX=10036 GN=CAD PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001107 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02142 all species →	MGS	MGS-like domain	Domain	Interproscan
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan
PF01979 all species →	Amidohydro_1	Amidohydrolase family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005483 all species →	Domain	Carbamoyl-phosphate synthase large subunit, CPSase domain	Interproscan
IPR011607 all species →	Domain	Methylglyoxal synthase-like domain	Interproscan
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR013815 all species →	Homologous_superfamily	ATP-grasp fold, subdomain 1	Interproscan
IPR006680 all species →	Domain	Amidohydrolase-related	Interproscan
IPR002195 all species →	Conserved_site	Dihydroorotase, conserved site	Interproscan
IPR032466 all species →	Homologous_superfamily	Metal-dependent hydrolase	Interproscan
IPR011059 all species →	Homologous_superfamily	Metal-dependent hydrolase, composite domain superfamily	Interproscan
IPR036914 all species →	Homologous_superfamily	Methylglyoxal synthase-like domain superfamily	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11405 all species →	CARBAMOYLTRANSFERASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006807 all species →	Biological Process	obsolete nitrogen compound metabolic process	Interproscan
GO:0004070 all species →	Molecular Function	aspartate carbamoyltransferase activity	Interproscan
GO:0004088 all species →	Molecular Function	carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity	Interproscan
GO:0004151 all species →	Molecular Function	dihydroorotase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006207 all species →	Biological Process	'de novo' pyrimidine nucleobase biosynthetic process	Interproscan
GO:0006228 all species →	Biological Process	UTP biosynthetic process	Interproscan
GO:0006541 all species →	Biological Process	glutamine metabolic process	Interproscan
GO:0019240 all species →	Biological Process	citrulline biosynthetic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0016812 all species →	Molecular Function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	Interproscan
GO:0016810 all species →	Molecular Function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009280-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009280-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

33.1Max TPM

7.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.92	9.67
polyp at pH7 6	18	18	6.70	10.77
coral polyp · control treatment	16	16	10.25	33.12
coral polyp · oil and dispersant treatment	16	16	7.63	32.75
coral polyp · oil treatment	16	16	6.06	17.93
coral polyp · dispersant treatment	16	15	8.20	26.46
Polyp	10	10	4.52	10.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.31
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.72
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.67
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.61
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.38
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.17
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.24
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.61
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.46
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.02
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.81
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.77
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.49
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.75
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.07
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.46
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.89
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.37
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.16
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.11
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.65
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.71
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.37
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.20
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.12
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.87
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.34
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.66
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.07
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.63
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.89
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.56
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.85
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.47
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.79
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.51
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.88
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.35
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.93
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.62
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.80
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.15
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.35
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.08
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.94
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.30
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.64
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.93
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.21
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.87
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.85
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.13
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.04
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.03
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.90
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.11
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.70
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.93
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.11
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.34
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.46
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.50
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.99
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.50
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.12
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.60
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.37
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.37
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.16
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.21
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.59
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.95
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.77
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.49
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.28
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.21
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.97

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.