Gene detail

Detailed information of OS493_009297-T1 in Lophelia pertusa

Genomic Location: scaffold_22:1554819...1571625
NR annotation: KAJ7373969.1, pre-rRNA processing protein ftsj3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009297-T1

ATGGGCAAAAAAACTAAAGTTGGAAAGCAAAGAAAGGATAAATTTTACCATCTCGCGAAAGAGACAGGTTACCGCTCACGTTCAGCTTTCAAATTGATCCAGTTGAACAGAAAATTTGGCTTCTTGCAGACAACAAGATGCTTAATCGACCTGTGTGCCGCACCTGGAGGCTGGCTTCAAGTTGCATCAAAGTTCATGCCTGTGTCAAGTATAGTAGTCGGTGTTGATTTGGTTTCTATCAAGGCTATTCATAATGTCATAACTCTTCAAGAAGATATCACAACAGACAGATGCAGACAGCGGACTGCGTTTTTGAATGATGGAGCTCCAAATGTTGGCGCAGCATGGATACAGGATGCTTTTACTCAGGCTCAACTAGCCCTCAGTGCTCTAAAGTTAGCTTGTGATTTCTTACAAGAAGGAGGATGGTTTATAACCAAGGTGTTCAGATCTAAAGATTACCAGCCTTTGCTATGGGTTTTCCAACAACTTTTCAAGAAAGTTCATTCTACGAAGCCCCAGGCATCAAGATCAGAGTCTGCCGAGATTTTTGTTGTATGCCAGGGTTACATAGCTCCTGCTAAAATTGATCCCAAACTTTTGGATCCAAAACACATCTTCAAAGAAGTTGAGCCTGAAGGGAAGAAAAAAATCAGTATTTTGCAAGTAGAGAAACAGAAAAAGCGCGCTGAAGGATATGATGAAGGCGACTACACTCTGTTTAGATCAGCTAAAGTCACTGACTTTCTTCAAGCAGAACATCCATTAGATATTTTAAGTTTGGTGAATGAGATCGTGTTTGATGATTTAAAATATGCCAAACATATTATGACCACAGAGGATATCAAAGAAGCTTGTAAAGATATCAAAGTTCTTGGAAAATCAGACATAAAGAATCTTTTGAACTGGCACAAAGCTCTACAGAAAGAGTTTTACGGAGAGGACCCTAAAAGTGGCCAGGAAGATGAACAGAACAACGTGGAGGAAACTGAGGAGGAAACTCTTGAGAAGACAATTGAAGGATTAAAGGAAGAAGAAATTGCTCTTATTAAAAGACAAAAGAGGAAAGTTCAACAGCAGAGACAAAAATTACAGGAGAAAATGAGATTGAAAATGATTTTACCAGGAGACACAAAAGACATGGAGACTGATATGGAAGTTTTCTCTCTTGCAAACATCAAAAGTAAACAGCATCTCGACAAAGTGGATGAAGCAGATGCGAATGAACTTGACATGGAAGACGAGAAAGAAGATCAAAGTGAGGATGAAGTGGAAATCGAATCTGCGTCAGATAACGAAAATGATGATGATGATGAAGATGATGATGCTGAAGATGGTATTGAGGATGATGGTTCTGAAAAGGATGATGAAGAATTGCAATTTGATGATGATGTCGAAGGAGTGGAGCCAGGCAGTGAAAAACAACCGAGTGATAAGAATCCATTGTTGGTAGATTTGCAGCCTGAAGTTCCTCTTTCAGCCAAAGCAAATATGTGGTTTGGAAAGGATGTGTTTCAAGGTTTGGAAGACGAGGCTGATGAAGACTTGGAGATTTCTCAGATGGTGGAAGAGTATAAGAATAAAGGAGGAACTATTTTAGAAAAGAATTCTGAACCAAGCGCGAGTGTTCAACAACAAGGGACTAAACGAGGAACGGATAAAACACCTAAAGAAGCGAAGAAGGAAAATGATTTCGAGGTCGTTCCAGTCGAAGATAACAGCGAATATTTGAAGAAGCTCACTCCTGAAACTTTAGCATTAGGACACAAGATGGCTTTTTCACGGAAAAATAAAAGGGACGTCATTGATTCTGGCTATCACAGATGGACGTTTAATGATGAAGGTCTTCCTGCTTGGTTCGCGGAAGACGAAGCGAAGCATTACCAGCGCCAGTTACCGGTTTCCAAAGAGATCGTGGCCGACTACAAAGCAAGAATGAAGGAAATCAACTCCAGGCCAGTGAAAAAGATCGCAGAGGCCAAAGCCAGGAAGAAACGAAAGGAAATGAAACGACTAGAGAAAGCCCGTAAAAAGGCGGAAGCCATTTGCGATACCGTTGATGTGTCCGAAAAAGAAAAAATGAGTCAAATTAAAAGTTTGTACAAAAAGGCAGTTCTTGGAGGGAAACCCAAAGAGATTAAGTACGTCGTTTCCAAGAAAAGTCAAGCCGCCAAGCGTATGAAGAGACCCGCTGGAGTCAAAGGTCCTTTTAAAGTCGTCGACCCGCGGATGAAGAAAGACATGAGAAGTCAACGAGCAAACGAGAAAAGAAACAAAAAGAGTGGAAAGAAAAGAAGATGA

Transcript

OS493_009297-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5RJT2	pre-rRNA 2'-O-ribose RNA methyltransferase FTSJ3 OS=Rattus norvegicus OX=10116 GN=Ftsj3 PE=1 SV=1
Q9DBE9	pre-rRNA 2'-O-ribose RNA methyltransferase FTSJ3 OS=Mus musculus OX=10090 GN=Ftsj3 PE=1 SV=1
Q5RAS1	pre-rRNA 2'-O-ribose RNA methyltransferase FTSJ3 OS=Pongo abelii OX=9601 GN=FTSJ3 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004026 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01728 all species →	FtsJ	FtsJ-like methyltransferase	Family	Interproscan
PF11861 all species →	DUF3381	Ribosomal RNA methyltransferase Spb1, DUF3381	Domain	Interproscan
PF07780 all species →	Spb1_C	Spb1 C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR028589 all species →	Family	AdoMet-dependent rRNA methyltransferase SPB1-like	Interproscan
IPR002877 all species →	Domain	Ribosomal RNA methyltransferase, FtsJ domain	Interproscan
IPR050082 all species →	Family	Ribosomal RNA large subunit methyltransferase RlmE	Interproscan
IPR024576 all species →	Domain	Ribosomal RNA methyltransferase Spb1, domain of unknown function DUF3381	Interproscan
IPR012920 all species →	Domain	Ribosomal RNA methyltransferase, SPB1-like, C-terminal	Interproscan
IPR015507 all species →	Family	Ribosomal RNA large subunit methyltransferase E	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10920 all species →	RIBOSOMAL RNA METHYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008649 all species →	Molecular Function	rRNA methyltransferase activity	Interproscan
GO:0031167 all species →	Biological Process	rRNA methylation	Interproscan
GO:0008168 all species →	Molecular Function	methyltransferase activity	Interproscan
GO:0032259 all species →	Biological Process	methylation	Interproscan
GO:0000463 all species →	Biological Process	maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	Interproscan
GO:0000466 all species →	Biological Process	maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	Interproscan
GO:0001510 all species →	Biological Process	RNA methylation	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0008173 all species →	Molecular Function	RNA methyltransferase activity	Interproscan
GO:0008650 all species →	Molecular Function	rRNA (uridine-2'-O-)-methyltransferase activity	Interproscan
GO:0016435 all species →	Molecular Function	rRNA (guanine) methyltransferase activity	Interproscan
GO:0030687 all species →	Cellular Component	preribosome, large subunit precursor	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006364 all species →	Biological Process	rRNA processing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14857	SPB1, FTSJ3; AdoMet-dependent rRNA methyltransferase SPB1	EC:2.1.1.-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009297-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

24.4Max TPM

8.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.54	10.94
polyp at pH7 6	18	18	10.55	16.59
coral polyp · control treatment	16	16	10.01	18.00
coral polyp · oil and dispersant treatment	16	16	6.74	10.18
coral polyp · oil treatment	16	16	7.50	11.82
coral polyp · dispersant treatment	16	16	7.99	24.39
Polyp	10	10	6.26	13.33

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.66
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.06
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.89
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.63
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.90
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.74
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.28
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.26
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.23
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.59
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.43
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.73
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.12
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.11
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.20
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.13
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.04
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.99
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.03
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.75
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.22
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.37
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.58
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.30
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.06
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.07
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.41
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.08
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.21
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.83
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.93
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.36
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.35
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.20
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.10
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.58
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.37
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.23
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.88
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.36
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.98
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.13
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.82
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.25
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.91
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.86
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.57
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.45
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.23
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.40
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.53
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.17
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.98
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.75
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.64
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.39
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.41
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.02
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.73
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.78
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.25
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.54
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.41
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.07
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.33
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.62
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.26
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.25
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.40
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.33
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.17

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.