Gene detail

Detailed information of OS493_009315-T1 in Lophelia pertusa

Genomic Location: scaffold_22:1741041...1754474
NR annotation: KAJ7373987.1, stem cell population maintenance [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009315-T1

ATGGAGGTTGGCGAATTGTCAGCAGAAGATGCCGTTACAAAAGAGGGGTTATCTAGTCAAGGAAAAGCTAGCCAGGAAAACGAAGGCCTTGCTGTCTCGAAGAAGGAAGGAGAGGAACAAATCGAGGAACATAGGCCACGTGTTGTGTACTCGAAGGAGGATTTACTCAATTTGAGAGAGTCTCCAGCATCTAAACTGTGGCCATCTATTCTTTCTGAGGAGCATGTCAGGCATGGTATATGGGATCCGGAGGCTTGGCACCAATCCTACTCTAGTGGAAAAAGATGTGCATCACCTGGGGACGAACTCAAGAAACAACTCATGATTGAGGATGGCATAGTACTGAGCCCTCAGCGTCAGAGCTTTGTTCAAGGCTGTCAGATTCCACAGAGCGCTCCTGAAAGAAACCTCCAACACGACAGAGTCAAGCCTGGCATAAGCAGAACAACTGATCGTGAAAGGGAGGGAAGAAGCAGACTGACTGGGAGAGTGGGCAGAGGAAGAGCCTTAGACTACAAAGAACGCACACCTTTGCAAGAAAGGAACAAGGATCCTGATGAACCATCAGGGAAATACTCGGGTCCAAGAGATAGGGAAAGGGAAGACAGAGGCGACAGAGACAGAGCTGAACGAGGATATGGCAAAGATAAAGACAGGGGATCGAGAGAAAGAGACAAGGAACGAAAGAGAAGCAGAGAAGAACCTCCCCGTGGAAGAAATATCCAAGTCAGGAAGAAACAAGCTAACACTCGAAATGCAGAGCCTGAATGGTTCACATTTGGTCCGTCAAGTCAATTTGAAACCATGGAGCTCAAGGGATTTGATGATGATGAAATTGCTAAAAGAGACCGGGAGAGACGCAAGTCAGCTTCAGACGAGATCAAAGCAATTTTGTCAGGGGGGAAGAAAGGCCGCATGAATGGTGAAGTGAAGAGTTCATCACCTGCACCCGAGAATAGTCCGTCGCAAAACAGAACTGACGACAAGAAGACGGCAGATGCTGAGGATGCCACTAATGCGCCTGCTGCTGATGGCAATAAGCAAAAAGCCAAGCCTTTTGACATCAATGACTTTTTCTTGAGTGACACGTTGCTCCCCTTCACAGGAGGGGTGGATCAATCCAGTAGTCGATTTTGCCAGTTTTTTGGTCAGCCAGGCAGTAACTATAGCAGCAGCAGAAGCGGTAGTACAGGTTTCTCGAGCGGCGGTGCCAACACTCCACGCACTCCATCACCAGGGCCAAACTATTTATTCACTCCCATCACAGCTTCAGTAGATGAGAGTGTTGAGTCGCACAGTCTGGCAAACATGCTGCAGAAATCCCAGATCAGTGTACAGCCCTTGTTGGATGAAGTGATGTCAGCAGGGATGGATAAAGTCAAGGGATCAGTCCGCTTGGAGGACATTGAAGCAGATGTTGTTACAAAGGACGCTGAGAGCTCCACAAAGAAAGAGATTATTGACCTGCAGCAGAAGCAGCAGAACAAAGAGAATATCAGTAAAGGTGGTGAAATGTCCATTGCAAAGGAGGAAATGGTTGCATTTAACATGCTTGTCGAGAAGATGAAGTCATCAGGCACGTTACCAGAGAAACCACAACCTGCAATCTCTGGCCTACCCACTCGTCTGTTGCCAAGACCTCCATCCCCCAAGAGGAAAACCCCAAGGAATACCCCATCTCCATTGCAGGATCTGAGGAGGTCCCCCTCACCCACTGAGCTGCTCAAACGGTTGACCATGCAGGCACCACTGTCAGATCACAGACCTCCGTCGCCAGCCCAGGTTGTGCCACAGATGAACAGACCTACCTCTCCCCTGGAGATGTTCCACAAGTACAACTCCATAGTAACACCACCTCACGATCTGTTTGCGTCTCCTTTGCTGCGGCGGTCACCCTCTCCTCTTGCTATGCTGGCACAACAGAGGCAGAGCCCTCCTCTTGGATTTGGCAGTGTTAACATGCACAGAGTGCCACCACCACAGGTCACATCACTGTACCAGACAGGACTACCTCACCCTGGTCTGCCTTACAGGGGAGGGCACGGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCCCTGAGGAGGCCACAGGAGAGATACGTTATGCCCGGTGGAGGTGCACCTGAACCGCGGAGCCAGGTGGCAGTGCATTCAAAACAGGTTTCAGCAGGGCAGTCCGGCTCTCCTCACATCCCAGACAGATCGTTTATGCCGACATCTGTCATGAGAAAGATTCACCAGGATCAAAAGACGCCAAAGTCTCACTCTGAAGATCAGTCCAAAGCAAGAAGCCTTGTAACTGAGGGGGAGAAGAGAGATGGTGCCCCCGAATTAACGCCAAGGCAGCCATTTCTGAGCTCAGCGGACCACGATCCTTCTCGTTTCAGGGGCCGTTCGCAATCTGGAGAGGCAGATGATCTAGTTAAAATGGGGCTGTTTCAACAGTTCGCTGGTGAAAGGCACGCCCCAGTGCATAACACTGCTGCGAGACAAGACCATTTACTCTCTCCAAGAACCATGATGCCAAGTGATACACAGTTATCTCAGACAGGCTCGCCAATCTTGCAGAAGCCAACCGCTTTTAAACCTCTGCCTGGGTCACCTCAATTGCCATTTTCTAGCCTCAAGAGTGGCATTCACTCCGAGCCCGCCTCTCCTCTGCATTCCTTCAACCAAAACGCAGGATCTCCATTGAGATCACTAAAACCGCAGCCACATTCAGCACCATGCACTCCTCAGCGCCATCCCTTAATTGACAAAGCAGCGCTGCTCTCACCTCAACAGTTGGCATCTAAAGGATTAATGACAAGGGATGACAACAGCAAGCCTCCTTTGGGATTGTTTGGTCATAGCACGTCCTTGGAGGGTCACGCTAAAGGTATTCGCAATGGTATCACTCGAGTTGTGTCGGCGAATGAAGGTAGGCCATTGACACATTCATATGAACAGCAGCCACATGTTGCCCCAGACAAGGCCGCCGCATCTATTTATGAAGACGTATTTCACGCGGCAAAGAGAAGCGAAAGTTTGTCGGGCGGTCATCCAGTGTCTCATCATCATAATCCAAATAACGTGCACGGCATCCAAAGGATGAACAGCTCTGAAGCGTTGACTCCACATGAGAATCTACCTCCTCACCACCCACACAGAATGCATGGAGGAGGTGCCGACACTAGACCCACGCCGGCCCATCACGTCCAGAGATCGTTTCACGGATCACACGGGCCGCGTCCCGGTCCACATGTGCCAAATGGACGCATGTCTCCGTCAGGCATGCCGGCCATGCACGGGCATCCAGGACGCACTCCGTTTAACTCACCCATGCCAGGCATGGCAATGCCACCCAGGTCAGCCATGCATCCTGGAATGATCCCGCCGCATCTACATCCAGCTTATATGAGGATGATGTCTTCGGGTGGGACGCCCATGGGAATGCCGCCCTCGCCTGGAATGAACCCGGCGTCCATGAGAATGCCCATGTCGCACTCGGCTGGGAGGTACCCTATGATGCCTGGACACCACCCTGCTGCCGCTGCCATGATGTACGGTGGGCGTCCGTCACCTGGTTACCCACCTGTAAACCCTGCGGCGGCCATGATGGCAGCAGGTCGCTCCCCTCACATGCCTCCTCAGTCGGGTCTTCAGCAAGTCCACGGCAGACGAGTTCCAAGTCCAGTCATGAACCATCCGCCACAAAGTCATTCCCCTGGGGGTGGTGGTGGCGGCGGCAATATCCTGTCAAGATGGTTCAGCGAAGATGTCCTTCAACAGGCCGCTCCAACACAGCGGGAAATCGCGCCAGATTTTACAAGGAAAGTGGTGTCTGTGGAAGAACTGGAACGACAACAGGCCGCGGCTATCAACTGA

Transcript

OS493_009315-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9NRA8	Eukaryotic translation initiation factor 4E transporter OS=Homo sapiens OX=9606 GN=EIF4ENIF1 PE=1 SV=2
Q9EST3	Eukaryotic translation initiation factor 4E transporter OS=Mus musculus OX=10090 GN=Eif4enif1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003915 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10477 all species →	EIF4E-T	Nucleocytoplasmic shuttling protein for mRNA cap-binding EIF4E	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018862 all species →	Family	Eukaryotic translation initiation factor 4E binding protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12269 all species →	EUKARYOTIC TRANSLATION INITIATION FACTOR 4E TRANSPORTER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0017148 all species →	Biological Process	negative regulation of translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18728	EIF4ENIF1; eukaryotic translation initiation factor 4E transporter	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009315-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

83.4Max TPM

23.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.08	29.24
polyp at pH7 6	18	18	20.22	31.09
coral polyp · control treatment	16	16	32.70	83.35
coral polyp · oil and dispersant treatment	16	16	33.18	77.50
coral polyp · oil treatment	16	16	26.42	32.63
coral polyp · dispersant treatment	16	16	19.23	25.70
Polyp	10	10	12.17	17.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.24
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.25
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.14
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.74
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.14
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.55
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.91
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.86
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.26
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.20
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.78
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.72
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.74
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.56
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.32
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.30
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.15
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.09
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.62
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.81
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.60
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.03
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.64
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.26
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.58
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.05
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.54
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.90
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.03
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.95
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.88
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.11
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.35
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.57
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.32
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.79
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.16
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.36
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.79
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.91
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.95
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.93
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.39
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.66
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.57
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.50
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.97
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.91
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.86
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.46
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.46
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.96
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.62
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.84
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.17
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.63
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.37
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.80
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.16
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.15
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.65
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.96
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.81
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.94
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.85
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.68
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.51
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.87
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.57
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.57
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.42
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.47
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.88
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.63
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.99
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.49
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.96
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.87
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.85
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.56
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.09
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.29
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.61
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.10
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.16

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.