Gene detail

Detailed information of OS493_009469-T1 in Lophelia pertusa

Genomic Location: scaffold_22:3193543...3207644
NR annotation: KAJ7374132.1, GTPase activator [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009469-T1

ATGTCAGTATCCTCCTCAGCTTCCTCTAATGAAAATCTCGACGAAATAACAGAAAGCAACTTGGAAAGGTTATTGCTGGAAGATGAAGGACTAGTGGATTTCTTTAACTCTTTCTTAGCATTACCATATAACAATGAGCTTGAAGTTTTTGAGGAATTCTTTGAGAAGATAGCAGATGATGTGGGTAAAGGAGACGCAAAGGGTGCCTCTGCGCTGCGTCAGTTCACACACTTTAAAGGAACCATATACGATGTGGCTGACAACCAGTCACGCATAGGTTATTATGTAACCATACTCGACAAGGTGCAAGGCCTTGAATTTGTAAAGAAATACAGACTGCCTCTGTTCCTGAGAAGTGAACTGTATGCTGAATATAAACTGTCCAAGCACTTGTCGGCAGTCCAGGAGTCATTTGTTCACTGCCTCTATTCTGAAAGCTCAGACGACGATGACAGTGGAGTAGAAGAACCTACTCTGTTACACCCCTCAGGGCGGAGACGAAGTGTGGTCAGTTTCAATCTGAGTCCATCACTTAATGATGCACAATCCACAGATGGCGAGGCCGACAGTGAGAATGAAGGCCATTTTTATCTTCCAACCAATGTGCGGTCCATTGAAGAAACGTTTGACGCATGGCAAGATTCGTTTAAACCGCATTCCGAAAGCCGCACCAGCATGTTTAGCAGTGGTGGAAGCTCTCCTTACCCACACTCTCCACAGATTAGGGAAGAAGACGAGTTGCTTGAGACACAGTCAAGCTCTAGCTGCTACAGTGCTCAAGAGAGCGATGCTACTGTTACAAATAACAACGTCAGGCCGGCCTCGCGCTTGAGCTTCGTAAGCGACAATTCTGAGAAGACATTGAGTCCTGAGCCCAGATCCCGGGTTAGCTCGGCCAGTAGTGTCTCATTAGTCCTGGAAACTAGCAGTCAGACTGGTTCACTCCAGGAGGGATCAAATGTCGGTGATAAGGATTCTAGAGATCCTCGTGGCGAGGATGACATGACACGCAGTTTGTCTTCAGTATTGAGCTTTATTACGGAGCATGGACAAGTGAAACGGAATTCTCCTCCGCTGGAAAGGTTTGTTGATGAGCCAGCTTTAGCAGCAGACTTGATTTCAAGGGAAGATATTGAAGGGGATGGTCCATATACTAGCAAAGAAGAGCCTGTTGTAGAATCAGAGGGCACTGTAGAACAGGAAGACTTGATTTCAAGGGAAGAAGTGGAAGGGAATAGTACAAACACTAGCAAGAAAAAATCTATGTTGGAATCCGAACCAGTTGTTACAAGTAGCATTATTATAGAAACCACTTCCATCGAAGGAACAGTGTCGGAACTAAACATGATCAAGTCGGATACTGGGAGGAGTGAAGAGGAGATTCCACCTGTTAATGAGATCCGAGTTAACATCACTGATAAAGATACGAAGGAACTTCCAGCTGAAGGAAATGTGCCGAGTATTAATGTAGAAATGATGTGTACCGGTGACGAAGAAGTGTTAGTTAAGGGAATTTCTTTGACTGTTACCTCCGCTGATTCCAATTCTGTGGCTGAAGCTGTTAATGAGGAGACCAGTGAATCAGTTCCCATTGATGGCCTGAATAAAGAATTGTCGGAGACAACTGAAGACCTCTTCAACGCAGACGAAAGTTTGTCTCTTTCGGACGCTGTTGTGGATTATTCCGGCTCGATAGAGGTCAGTCGAGGTGAAGAAAGGCAAGAACTTGAAGTTCAAACATCGCAGAAAGACGACGTAAAACCCATTGGTTCCGATGAGGAAGATTGCCTTCATTGTAAAAAATTTTCAAAACGCAAGGATGCCATTCCTGCAACTAAGGCAGCTGTGGACAATTCACCAAAAGAATACAACAGTTTAAACGATGAAGATTCAAAGCAGTCCAAATCGTTAGATTTAAACTCTGACACTGGAGAGACAGCCTCGGTTGACGAGTACAGTGTACAAAAAAGCACCGAGAATGAAAGCATTGCTGAAGAGCAAGCGAGCCTGGGAAAATCCACATTAAGAGAACTCGACCTGGACTCTGACATTAGAAATGAAAGGAGTACGTTTGAGATTCGTGAAGACAATGATGATGATGAACAAGAAACAGCGGAGAAGGAAAACGAATCTGAAGCACTTGATTCCCAGGACAAAGAACCAGATGAAGACGACGAAGGTGGTTACACGACCGAGGCAAGTGCTACAACACTGCAAGGAATCCGCGGCGTGTTTGGCAAAAGGCGACGTTGCAGTACGGCCGCTACATCGGTCGCTTTCGATGTAGCTGATGAATCTGCATTCAGCGAGGACGGATCGGAAATGGAGGAAAAACCGTTTGATTTGGCGACTAAGGAAGGTTTGGATGGATTCAAGGAGTTCCTTTTGGAGACGAGTGGCGAGAAGCTGTTGCAGTTTTGGCTGGAAGTTGAGTGTGGAAAGTACTTGGAACATGACGATGAAAAAAGCAGATTGGTTCAATGTTTACGTGACCGGTTTTGGAGAAGTGGAGGAATTTACGAGTTTTCCGCTGGCACTAAATCCAGATTAAACTTGGTGGATGCGTCGACATTAACTTATGACAGATTATTTGTCATTCAGCCTGATGTCCTTGAACCTCTGTTGAGCTATTGGTGTATACGGTTTACGATGCATCAGCAACGCACTTCTCATTGCGGCGACCTGGAGTACAACAGACTGTCAAAAGAGAGACCGAAATCGTGCGTGAAGCGTGAAAACGCACTTTCAAACCTGCCTCAAGTCCCTGTGCACATGGGTCTGTCCCAGGTTCTCCCGAACAAAACAGTGACCAGGCCCCAAAGTAGCTATGTCAATAAGACGGGTATTCAGCACCAGACCTCCCGGCCTCAAGTTCGCGCCAAATCCGCGCATCCGCGGCTTCTCCAACCTCCTAAATACATGCATACTAATGCGAGTACAAAACAACTGCAGTACATCATTGCCCCTGTGAAGACTGGATATGGGTTCGAGCAACCCCCAGGACCTTCCTTTCCTGTTGAACCGGAACCAGACTACCTACCCTCCGTCAGGCTCTTTATCAACCCTGTCCCCTCCCCTGATAGTAAGATTCAGAAAATAGTGAGGACGCTGCACCGAACGGCTGTATTCGCTGACGATTCCACGCCGGCTTCTGTCAAGGAGACTGGGACCAAGAGTGGCGCCATGTTGGATTCATTGATCCAGGGACTGATTTATGAACGGCAGACTGGGAACTACTTCAAAGTGTTTCTACAAAACTCAGGAAATGAGACAATGTACGCCAATTTCGTCGTGTCGGGCAGCGCGCAGGATGTCCACGTGCACAGGGACATTCAGCTGCAGGTCCATAAAGAACTGGAGCCACCGTATGAAGAGCTATTCGATGCGGTCGAGGACCATGTTCTTCACTCACTTCTGGAACCCTGGAATATGCTTATCGAGCAAGAAAAAGACTTGTATTGTCTTGAGGTACCTACTGAACAGAAGCTGAGGCATATCGAGATCAAGATGTTGGCTACTCGCAGACAAAGTATCGTTCAGACTCATGGAGGGCTTGGTAATGCCGAGGATGAGCACGAGAAAGAAAGGATTTCGGTGGAAGAAGCTAACAGACCGTTTCCTGTACCAAAGGACGGTTCACGTTTGAATCTCTCATTAGAAACAGAGACGAAGTTGAACATTTCAAAGAATTTCTCAACAAGAAGCACGCTCGAGGTATCAAAGATCTGA

Transcript

OS493_009469-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NE09	Regulator of G-protein signaling 22 OS=Homo sapiens OX=9606 GN=RGS22 PE=1 SV=3
G3UYX5	Regulator of G-protein signaling 22 OS=Mus musculus OX=10090 GN=Rgs22 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004643 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_009469-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR042651 all species →	Family	Regulator of G-protein signaling 22	Interproscan
IPR036305 all species →	Homologous_superfamily	RGS domain superfamily	Interproscan
IPR016137 all species →	Domain	RGS domain	Interproscan
IPR044926 all species →	Homologous_superfamily	RGS, subdomain 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46583 all species →	REGULATOR OF G-PROTEIN SIGNALING 22	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0001965 all species →	Molecular Function	G-protein alpha-subunit binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0009966 all species →	Biological Process	regulation of signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009469-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009469-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

17.2Max TPM

6.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.76	12.78
polyp at pH7 6	18	18	5.80	9.86
coral polyp · control treatment	16	16	8.53	17.19
coral polyp · oil and dispersant treatment	16	16	6.84	10.61
coral polyp · oil treatment	16	16	7.40	13.95
coral polyp · dispersant treatment	16	16	5.20	10.70
Polyp	10	10	2.42	4.77

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.78
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.69
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.26
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.11
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.97
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.88
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.77
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.75
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.29
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.29
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.18
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.06
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.35
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.23
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.59
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.30
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.86
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.55
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.28
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.04
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.03
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.49
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.29
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.93
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.13
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.10
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.02
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.19
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.71
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.31
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.24
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.98
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.81
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.51
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.79
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.54
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.24
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.96
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.53
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.82
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.21
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.04
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.36
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.33
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.25
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.11
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.45
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.22
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.00
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.41
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.33
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.43
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.95
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.86
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.25
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.06
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.39
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.00
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.77
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.70
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.48
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.94
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.66
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.80
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.56
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.53
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.52
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.11
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.99
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.11
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.72
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.10
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.77
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.98
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.53
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.01
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.40
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.33
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.47
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.17
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.69

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.