Gene detail

Detailed information of OS493_009479-T1 in Lophelia pertusa

Genomic Location: scaffold_22:3257023...3273325
NR annotation: KAJ7374142.1, Protein phosphatase Slingshot 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009479-T1

ATGCAGTACCTGACTTTACTCTCCAAGACGTTCAACGATTTATTGTTCTGGTCAAGTTTTGAAGGTTTCTTTGCATCCAAAGGAGCAGCGTATGCTTTACCTGATGGAGATTTCGCTCGGCGGGCTACCAAACATGGAGGGGAGATGCAATTGCATTTGCAGGCAATGGTCAATTTGTTACGCGATGAAGATGTTCTCAGACTTGTTGTTAAATTGGAATGCCAGTATCCAAACAGAATTCGCTATCTAACAATTGTGTCGGCATTCGGTCCAGATGAGGAAGAACAGAGTATTATCATGGGAATCGACTGGACTGACAAGGCCACCATTGGTCTTGTGGTTCCTTTGTACAGAGACACAAGCATCAAGCTGGATGGCGATGGTGGCTTCAAAATGACTTCAGCTGACAGAACAAACATTTTCAAGGCAATTTCTGTTCAAACCATGTGGACTGCCCTTCAGTGGATTCACAAGTGCGGCGATAATGCCAGGAGACACAACTATTACTATCCAAATGGTTCATCACACGCCTGGGTTGACTATTATTATAGGAAGATATCCTCAGACAGAGTTTGTATCAATGAATGGGAGCAGATGGATGACCTTTTTGCTAAACGCCCTGAATCCCCCATTGGAACAAGTACTGAAAAAGAACTTATTATGAAGCTTATTCGCCACAAACTTAGGGAGGTGATGACGAGAGTCGACCTTGAAGATGTCACCTGTAGACAGGTGCGAAACATGGTTGAAGAAGATACACAAATGGAACTTAAAGAATACAGGTCTTTTATTGATCAAGAGATGATAACCATCATGGGACAAATGGACTCTGCATCCAAAATATTTGACCATGTTTACCTTGGTTCTGAATGGAATGCTTCAAACTTGGAAGAACTCAAGGAAAATGGAGTTGGATTTATTTTGAATATCACGAGAGAAATTGACAATTTTTTCCCTGGAACATTCTGTTATCATAACATCAGAGTTTATGATTTAGATGAAACTGAATTACTTCATCACTGGGAGCACACTTACAAGTTTATACAAAGAGCCAAAAATGCAGGTTCAAAATGTCTTGTACATTGTAGGATGGGCATTAGCAGATCAGCATCAACGGTCATAGCTTATGGCATGAAGGAGTATGGTTGGTCGTTAGGTGACACGATGAAGTACGTCAAATCTCGAAGAAGTGTTGTGCAGCCGAACGCTGGGTTTTGGAAGCAGCTTATCACATATGAAGGAATTTTGAACTCGAGCAAACAGCGCTTCAATAAATTGTTCAGACACGGGTCATTCTCGGCTGAAACAGAGGAGGAGCTGAAAAGCGCAGGAGCTGTAAAGAAGCAGAGAAAAGATTCTCCTAGCACTGCCGGCATGACTGTTGAGCAATTCGAGATGGCTCTCCAGTTGGAGGGTGTTGATACTGTAGACAATTTACCAACAGTAGCTGAATCTGATTTAAAAGACGAACAATCTGTTGACGAGAGTAACGAAGAATCTGGCGTAGTTCAGACGACCTCAGAGACTACAGATAACGTATGTCTCATCGAAGGAGCTTCGCTGGAAAGTGGCAATGCGGGTTCTGTGCCAGTGACTAGTTCCCCAATTGCTCCGGACTCAGAAATGACTGTTGAACCCAGCAAAGACGCCCTCGAGGAGACTAATTCTGTGCAGTCAAGTTCTCGTGTTTCGGAAATCGCTGGGATAGAAAATACTTCGTTGCATAGAGTTAGCTCCGTGCCTGAACTGCCGAGCGGTGACCCGAAGAGACAAGAATCAGACGATGAGTCTTCGGGGAACTTTCGAAGGTCGTACTCTTTACGCGAGCGCGGACCTAGAAAACTGCAACAACTTCCCACGAAAATTAAGTCGGCAAGCGACGAAAATCTGAAGGAATTCGAGCGAAAAAAGAAGGAAATTCTTTGCCTTGAAGATCAACCAGAGGTGAAGGATTCACAAGATGCGATGAACGTTGAGAAGGAATCCACCGTCGAAGGCACGGCGGTCTGCCGACAGAATTACACGGTGTGCTCGAAAGTGGTTTTGTGA

Transcript

OS493_009479-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q76I79	Protein phosphatase Slingshot homolog 1 OS=Mus musculus OX=10090 GN=Ssh1 PE=1 SV=1
Q8WYL5	Protein phosphatase Slingshot homolog 1 OS=Homo sapiens OX=9606 GN=SSH1 PE=1 SV=2
Q76I76	Protein phosphatase Slingshot homolog 2 OS=Homo sapiens OX=9606 GN=SSH2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003902 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08766 all species →	DEK_C	DEK C terminal domain	Domain	Interproscan
PF00782 all species →	DSPc	Dual specificity phosphatase, catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029021 all species →	Homologous_superfamily	Protein-tyrosine phosphatase-like	Interproscan
IPR020422 all species →	Domain	Dual specificity protein phosphatase domain	Interproscan
IPR000387 all species →	Domain	Tyrosine-specific protein phosphatases domain	Interproscan
IPR016130 all species →	Active_site	Protein-tyrosine phosphatase, active site	Interproscan
IPR014876 all species →	Domain	DEK, C-terminal	Interproscan
IPR043587 all species →	Family	Protein phosphatase Slingshot-like	Interproscan
IPR000340 all species →	Domain	Dual specificity phosphatase, catalytic domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45864 all species →	SLINGSHOT PROTEIN PHOSPHATASE HOMOLOG	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006470 all species →	Biological Process	protein dephosphorylation	Interproscan
GO:0016311 all species →	Biological Process	dephosphorylation	Interproscan
GO:0003779 all species →	Molecular Function	actin binding	Interproscan
GO:0004721 all species →	Molecular Function	phosphoprotein phosphatase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0016791 all species →	Molecular Function	phosphatase activity	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0030837 all species →	Biological Process	negative regulation of actin filament polymerization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05766	SSH; protein phosphatase slingshot	EC:3.1.3.16 EC:3.1.3.48	Protein phosphatases and associated proteins	ko01009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009479-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

36.0Max TPM

17.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.58	25.10
polyp at pH7 6	18	18	14.16	23.10
coral polyp · control treatment	16	16	20.97	31.87
coral polyp · oil and dispersant treatment	16	16	23.09	36.03
coral polyp · oil treatment	16	16	21.57	32.96
coral polyp · dispersant treatment	16	16	18.39	27.37
Polyp	10	10	3.65	6.32

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.10
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.34
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.25
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.07
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.66
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.30
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.54
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.39
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.31
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.68
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.09
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.80
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.90
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.38
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.72
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.33
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.27
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.94
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.18
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.55
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.70
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.04
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.50
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.43
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.04
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.78
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.57
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.88
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.48
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.87
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.28
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.50
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.99
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.10
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.33
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.02
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.69
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.54
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.65
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.03
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.02
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.23
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.29
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.60
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.21
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.20
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.24
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.83
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.37
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.35
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.98
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.96
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.85
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.70
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.89
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.44
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.62
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.25
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.99
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.27
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.23
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.91
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.78
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.37
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.85
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.11
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.94
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.86
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.31
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.07
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.40
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.98
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.54
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.26
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.85
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.32
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.15
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.85
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.73
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.42
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.45
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.31
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.15

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.