Gene detail

Detailed information of OS493_009577-T1 in Lophelia pertusa

Genomic Location: scaffold_23:431845...437471
NR annotation: KAJ7363424.1, hypothetical protein OS493_009577 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009577-T1

ATGGCGGCAAACTTTGAGCTTGGAAGCTGCAAGTTGCTACGATCAAACATCAATTATTTGCACCAAAGTCTCCGAGTATACAGCAAAAATACTCAAAAAGTACAGTCAGGAGAGCTAGTCTGGACTGATGGAGAAAGTGTGTGGCTGACACCCGTAAATTTCAGTTCCCACTGCAGAGAAACGACTTGTATCTCAAAGGAACGTTGTTTAATTGGAGAATTCAGAAGCCTCGTTTTAGGAATATCGTGCAGTGCGTTCACTAAAGAATCCAGTGGATATTATATTGCGGTTATTTTGAAAGAAAAAGTCGTGGTTTTGTGGAGGAAAATTGGAGAAACCTTGGTTAAACTGGTGAAGGAGTACTTTACAGAATGTGTTCCTCAAGGTTGTGAGTGGCAGCCCACTGTTCCATTGTTAGCTGTGCTGTCCAAAACATCGGCGGTGTTATTATGCATTTCAGAAGAATTTGAGTGTGATGTGATCTCAATACAAACATCTGACAGAAATTTACAAACTTGTGCATGGAGCAAAAATGGAAAAAGTCTTGCCATTGCAGTGGAAGATAGTTTATGCATATTTTCATGGACTGACTTGAGCAAACCTAATCACTTCAGTTTTGTTCAATGGAACAGTCTCAAGTTGACTGGCAAAATAAATTGTATCGTTCCATGGCAAACATCTTCATTTATCATTGCAACAGAACTTCCTTTGGACAAGCTCTGTGGCAATAGTGAAAATGATGGTGATGTTTTTGAGGTGCAAAATATTCATTTTGGGCAAGATACTTGTAAAGGCAAGAAATCTAACTCACCTATTGTTTGCTCAGAGGATATTGATTTCACAATTCTCACTCAAAGCGCTGATCAAGATGTAAATTCACTGTTAAAGTTGAAGCTACGAACGCCACGATTTGAAGCCTCGGCGACCATGGCACAGATTATTGCCATATGTTGTGAAGATTCAAAGCCTAGAGAGATCTGCAGAACAAGTATAAAGGGACTTATTTCTCCTGATTTACTTTTATTCCAGTCTGCAACAAATACAGTTATGGTAGGGAGTCATTGTTGCAGCAGGCTTCATTTCTACACTCTTCGTCAATCCAACATGAACAGCAAAACTGAGTTTGCGACAACGGAAAAGCTACTAGAACTGGATCCGATCACAAAACCCAAGGGAATATGTCTTATTCCTGGATGCACCGACGGCTTCCTTGCTTTACTTGGGAAACCAAAGCCAGCGGTATTCAACATGGCGACATTTCCACCATCTGCTGTTTATGAGCAGTATGATGTGAGTTTAAGGTGTTTCAGTGCTGTGCTAAACGAAGACAATAAGAAATTTGAGGACAAGTTTGATCAGCATCAAAGCACGGTTGAAGATGGAGGACATGCTGTATGTACTGTTGTTACAAACAGTGAGCATTCGCCATCCTTACTAAGGCTTCCTGATGGAAGAGTTTTTAATGGGTGTGTCGCGGCAATGGGGAGTGACAAGACCTCTTTAATATCTGAGCTGGAATTTAATGAACTTCCAGAGTTGCTTGGTCACTCCAAAGAAAGTTTTCAAGGAGCACAAAGCAGTTGGTACAGCCACGTACAAGAAGTAAAGGCAACGATGACCACAGCTGTTTCACAGATAAATGAAAGGTTGTCCAATTTGGACAAAAGGATAAATAAAATAGATTCAGATCGGGATGTAGAGAACAAACAAACCATCTATCCATTACCAGAAAATGCAGAATTTGTTTGCGTGGTGTGGACAGATGAACTAACTGGTGCTGTGGAGCAAGAGAATTTCCTTCTGGACAAAGGACGACTGAAACTGAAGACAATCCAGCAGGCTTTTAATGCTTCTCTTGTTAGGATAAGTATTGGTGATGTGCCTTGTATTGTGTCATCTGGAGAAGGTGGTTTCATCCCAGTGCGATTCCTCAGTGGCTCTACAGTTCAAATGTCAGGACACTCTAAACATCAGTCAATTAGCACATAA

Transcript

OS493_009577-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9H6R7	WD repeat and coiled-coil-containing protein OS=Homo sapiens OX=9606 GN=WDCP PE=1 SV=1
Q5ZKI7	WD repeat and coiled-coil-containing protein OS=Gallus gallus OX=9031 GN=WDCP PE=2 SV=1
Q5RFV8	WD repeat and coiled-coil-containing protein OS=Danio rerio OX=7955 GN=wdcp PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010622 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15390 all species →	WDCP	WD repeat and coiled-coil-containing protein family	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR028041 all species →	Family	WD repeat and coiled-coil-containing protein family	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14897 all species →	WD REPEAT AND COILED-COIL-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0019900 all species →	Molecular Function	kinase binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009577-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009577-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

5.7Max TPM

2.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.36	3.83
polyp at pH7 6	18	17	2.34	4.11
coral polyp · control treatment	16	16	2.24	5.65
coral polyp · oil and dispersant treatment	16	16	1.08	3.17
coral polyp · oil treatment	16	16	2.08	4.08
coral polyp · dispersant treatment	16	16	1.17	3.41
Polyp	10	10	2.54	4.80

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.83
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.56
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.43
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.53
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.49
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.39
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.14
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.11
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.95
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.87
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.87
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.78
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.63
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.33
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.26
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.19
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.08
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.03
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.44
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.10
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.70
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.42
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.36
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.32
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.65
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.57
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.80
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.78
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.79
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.15
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.68
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.17
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.67
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.72
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.61
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.55
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.41
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.19
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.57
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.70
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.30
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.85
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.78
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.71
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.42
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.41
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.19
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.83
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.83
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.48
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.46
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.80
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.41
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.58
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.85
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.45
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.79

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.