Gene detail

Detailed information of OS493_009709-T1 in Lophelia pertusa

Genomic Location: scaffold_23:1848786...1857733
NR annotation: KAJ7363550.1, Adenylate kinase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009709-T1

ATGAACAGATACTCGTTTCCAGTCCCAGCACATTCGTACCCAGTCCTTAATGAGCAGATGTTTGTTTCCAGTCCTACGCCTAATTTCAACTTTCGTTACCAGGCCCGTAAAGCGCAGAGAGACAGCGACGACAGTGAGGAGGAAGCAGACGAAGACGAAGACGAAGATGATATTGAGGCGCTGTTGGACGCTGAGGAAGAAGAAGAGGAGGAAATGGAGGAGGAGGAAGAGGAGAGCGAAGAGGACGCCATTGAACGATTGAAAACAGAGATTGGAGATCGCTATGACGAGGAGACGGGACGAGTGGCTACTGTGCAGGAAACGCTGGAAGAGATTTCAATTCCTCGAGTTGAGATCAATGGCGGGCGAAAGCCGCGGATCGTGGAGTATTGTATAAAGAAAGTTCTCAAGCCGGTGGTAGATTTCCGTGAGAGTCTGTTTGACCGCTGCTTTGCTATTGATGGCTACCTGGCCAACAGAATGCTCATCATGGGATTCAAGTTTCCAAGTCGCTTTGGAAGATGGTGTCCGGTCAAGCTTCTGGAAGGCGAAGTTCTCCCGCCCCAGCACGGTGCCGGGGTTTATACTTTCCCTGTGGTGTACCGGCAGCATGTGTACTTCTGTTCGGGACGGGACGAGAGGGAAACGTTCATGCAGTGCCCGTCCCGTTTCTTGAAACAACCTTCTCCTAAGCCTGTTGTTCCTATCAAGATGGCGATTATCGGACCTCCCAAGTCTGGAAAGACTGGACTGGCGAACCGTTTTGTGGCGGAGTATGGCGTCGTCAGACTCTCCATCGGTGAAGCGATCAGAAAAGTTCTGAATTTCCAGCCATACACTGAACTATCTCGTCAAATCAACCTTCACCTCAAGGCTGGTAACCCTGTGCCGGATGAACTGGCGGTACAGGCTTTGGAAGTGGCGCTGCTGGACATGCAGTGCCAGACACGAGGGTTTATACTTGATGGATATCCTGTCACCAAGAAACAAGTGGAGCTGATGACCGAGCGAAAGATCATCCCCGTCAGAGTCCTGGAACTACAAGTAGAGGACGATGAGGTGTTGAGGCGAGGAACCGCTGACCGTCACGCTCCAACAAGGGTTCTTCCTTTGCACGACAGTCAACAGATTCTCGGCATCAGGCTCAACGCTTGGCAGCGGGAGATTACGGACGTAAGAGACTGGTACAAAAAGGAGCACAGAAACTGGTTGCCCGTGGACGGTCAGCGATCCAAGTGGTGGATTTGGAGCGAGGCTCTGGACGAAGCGAGGAAAAGTGTCCGTCAAATTCAAACCTACTTACAGAGATTATCAGAAGGTAAAGCTGCCTCTGTTGCTGACATGTGTATTACGCCCAGTGAGTGTCTTCTCCGCCTGGGCGACTATGGTCAGTACTGCCCAGTTAGTCTGGCTGACCGCGGGGAGCTGGTCGACTGTTCAGTGAACTCTTCGCTGGAGTTTGCCGCTGAGTTTCGCGGGCGATACTACAAAATGGGGTCGAGAGTGGAACTGGAGCTCTTTCTTGCCGACCCTGCTCGCTACGTACCTCCCTTGGCCCCCAGAAAACTCCCCGATCCTGAGCTCCTTCCGAAAAGGAGGAGTGCCGCGGATGTTAAGACCTTGTTCCCGAAACAGATTGAACTGAAAGGCTACTGTCCGGTCACGTACTTGGATGGCAAGCTGAGGTACGAAAACATCATCCCTGGAGAGACAGACTTGGTTGTGGAATACAGAGAAAAACTATTCTGCTTTGAGTCCGAAGACAAATTGCAGAAATTCATGAGGCTACCAGAAAAGTACTACGGACTTACATTACCACACAAGTTACCGCCCCGCAAGGAGCCCTTACTTGTTAGTGGACTCCCCATGTTAGGTTACATGGAGCAGAGTGTGGCCACTGCTCTCACGAAGGCGCTGACTGCAGTGGGATGTTTTAAACCCAAGTATCCGTTTGTTGACGCCAAGAAGTCTGCTTTGCTTTACATCGCTTATCATCTTAAAGCCTACAACCCCAAGAGTAGCGACTACGTTCGTAAGAAATACAAACAGAAATTGATGAGATTCGAGGAAGAGTGTGAGCTGATTGGCTACCTGGGTAAAGAGATGACCAATCGCTATCGAGAACCAGAGGAACTTCCAATCGACTTTGATCACAAGCTGTCAGTCTTTCTGGCACTCAAGGAGACAGAACCCACAACCACATGGTGTGCGTGA

Transcript

OS493_009709-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5TCS8	Adenylate kinase 9 OS=Homo sapiens OX=9606 GN=AK9 PE=1 SV=2
G3UYQ4	Adenylate kinase 9 OS=Mus musculus OX=10090 GN=Ak9 PE=2 SV=2
C5CC42	Adenylate kinase OS=Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230) OX=465515 GN=adk PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003750 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00406 all species →	ADK	Adenylate kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000850 all species →	Family	Adenylate kinase/UMP-CMP kinase	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23359 all species →	NUCLEOTIDE KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004017 all species →	Molecular Function	adenylate kinase activity	Interproscan
GO:0004127 all species →	Molecular Function	(d)CMP kinase activity	Interproscan
GO:0004550 all species →	Molecular Function	nucleoside diphosphate kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006139 all species →	Biological Process	nucleobase-containing compound metabolic process	Interproscan
GO:0006165 all species →	Biological Process	obsolete nucleoside diphosphate phosphorylation	Interproscan
GO:0019205 all species →	Molecular Function	nucleobase-containing compound kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009709-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009709-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

65.5Max TPM

25.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	22.74	28.85
polyp at pH7 6	18	18	23.43	32.01
coral polyp · control treatment	16	16	30.21	65.55
coral polyp · oil and dispersant treatment	16	16	22.66	40.92
coral polyp · oil treatment	16	16	27.04	36.88
coral polyp · dispersant treatment	16	16	26.34	39.04
Polyp	10	10	23.23	35.80

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.85
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.88
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.84
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.90
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.01
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.47
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.56
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.70
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.99
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.25
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.94
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.41
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.55
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.42
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.97
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.01
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.80
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.04
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.44
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.55
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.33
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.87
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.46
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.81
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.40
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.08
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.79
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.75
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.71
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.55
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.14
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.72
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.30
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.35
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.17
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.61
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.11
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.86
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.17
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.70
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.16
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.27
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.51
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.82
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.52
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.02
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.98
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.44
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.35
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.64
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.03
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.59
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.53
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.88
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.27
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.07
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.34
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.48
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.35
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.42
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.30
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.15
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.85
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.16
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.10
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.04
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.93
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.16
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.07
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.17
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.09
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.86
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.47
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.60
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.63
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.92
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	35.80
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	33.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	29.46
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	27.04
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	24.51
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	19.16
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.20
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.61
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.