Gene detail

Detailed information of OS493_009735-T1 in Lophelia pertusa

Genomic Location: scaffold_23:2091411...2137217
NR annotation: KAJ7363575.1, hypothetical protein OS493_009735 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009735-T1

ATGAGCGAGGTGGACCGTGTGGTGGAGAAATGTTATCACGTGCTGGAGGGGACGGAGGTGGAGCTCGAGGACGCTCTGAGGAATCTAAACCGTCACGCTGGAACCATCAAAGAAAGCGGACCAGGCTCGGTTCCAGATCTCGCCAGGCAGCTCACGAGCAAGAGAATCGCTGTAACTGTGATCAGGAAAGACATGGATGATTATGAGGATCGTATGTCGGACATTCGTGGGAAGGTTGATAAAACTCGTCAGGTTCTCGAAGGAGAAATCCAGCGGCGACAGCAGATGAAAAAAGATTTTGAGACAATTCGAATGTGGGTGGTCAAGATTGAGGTACTCATCAACTCTAAATTGACCAAACACGAGGAGATCGACGAGAGAGAAATTAAGGCTCTAGAAGAAGAATTTTCCCTAAATCAATCACTCGTGAACTCGGTTGAATCCACGTGCAATGAACTGAGCAAGACGCCCAAAGGTTCTGCCTACCTCAAGTTAATTAAAGAACTGGAGCAGCTCCGAGCAAAATGGATGACAATCCACACCAAGTTTGAAGAACTTAAAGAACAGCCTGGCAAGAAACTAGAGGCGGACTTTGACACGCTTCATGGTCAGACATTGACAGATTTGGACAAAATACAACGAGGTGTGAAAAAGCTCAAGTTAGAGTCTGCGGAGCCGAGGAATATCAAGAGCCTTCTGGATAAATGTTTGTCGTACAAAGATGAGCTGTCCACGATCAAAAAAGACTTGGAACAAGTCAGGAAGCTGGGGTTCCAGATTATGGAGCGAGCGCCAGAAGAAAAGAGGACTGGGGTCGACAGACGAGTCGAGGAGGTGGTTCATGAACACAGGGAGCTGGAGAAGAAAGTTCGAACAAAGGAGGAGGCGTTCCGTGAAGCATTGCCGTTAGCTGAACGACTGGAAAGCGATATGAGCAATCTGGAAAACTGGCTGGAGGACAAGACCAGTGATGTGAAGAGGAGAGAAGAAGCAGGCTTCCCTGAAGATGTGGATGCCGAGATTAAGTGGAATAGGGGTCTTGTACAAGACGTCACAGGCAAAATGTCCGACGTACAACAACTCACACAGGTCGGACGAGAGTTGGTAGACCTGTCCGAAACAGGCCAACTCGAGAACTTAGAAGACAGACTAACACGCATCAACAATGCATGGGAAGATTTGAGTTCGGCCGCAGAACAGAGAATGACGACTTTGCCAAAGTACAAAGCCAAGCTTGCAGATTTCGAAAAATCCGTGGACCAGATGAACCAATGGCTGGAGGACATGGAGAAAGAAACCAACAAAGTGCACCCCAAGGAAGAGGAAGTGGATTTAGCCAAAAACAAAATTGATGAGATACAAGAGAGCATCAAGAACCGTGAACCACAGCTAGACCTGATCAGGAAACAGAGCGGCGAGTTCGTTCATCGTGGCCGTCAAATCATGGAGCCGTACAAGCGACTGCTCGACAGACGCTGGGAGGATCTGTCCTCGCGTATCGGCCAACTGGAGGAAGAGTTAGAGGACACGAAAAAGAAGGCTGAGGAAGCGAGAGCTAAAGGAGGACGAGTGGAAACAGAGATTATCGTCACGGAGCGCAAGACAGTCTCGTCGACACCCGGAGGTTTAATTGAAGAGTTTTTATCAAGAGAAGAAAGAACAGAAACCGACAGTGGACAACCAATTATTGAGACCATAACCACTCATAGGACCTACACTACAAACACTGCTCCAGACTCCTCACGCTATGTTGATGACGACTTCCAGAGGCGTTTGGATCAGATCTTGTTGGATGTAAAAGATCTTGAAGACCTCATCAATGACATCCAGTCACCCAAGAAGACGACAGAGAATGAAGTGAACGAGAAAATCAAGGTCGCAGAGAATCAAGTCGACAACCTTCAGCCGCGCGTGGAACATCTGCTGAAAGAGAGCAAAACTCTTGCTAACAGGGAGGGGGCACGGGGAGATCATATCCACCAGTCGTTGCTTGACCTGTCCAGCCGTTGGCTAAAGGCCTGTGACGAGGTCGACAAACAGAAGAAGGCGATTCGTATCGTGCCCAACTGGTATCAGTTTAGGAGCAACTTGGATGACATCGATGGGTGGCTCAAGAAGATGGAACAGGGCACGGAGTTAGAAGTGCAGCCAGAGGAAATCGAGGAGCAACAAGCCAAGTATGAAATGGTGTTCAAAAACATCGAAGAACTTGACAGACAAGGGGTGCAAATCCTGAGATGCTACCTCTTACCGCATCACAGTTCACACACGGGTGACGTAAAGGATGCCGGGACACAGTCCAACGTGTCCGTCGCACTGTTCGGCGAGAAAGGAAAATCGTCGAAACTTCGCCTGGACAAATCCGAGACGTATAACACCAAGTTCTACCGCGATCAGCTCGATATCTTCACGGTTTACAACGTGCCACATCTGGGCGACTTGCACAAGATCCAGGTTTGGCACGATGGGACTGGGCACAAGCCTGACTGGTTTGTAAAGGGATTTTACATCGAGGATAAGTCCACTCGAAAGGTTTACTTTTTCAATTGCAACGCGTGGATTGGTCGAGATGCTGACATGCAAGATATCAAGTGTGAAGGTTATACCCTGCCTGAAGAGGGCGAGGATGTCATGACCAAGTCCTCTCTAGCGCGCGTCCGCTGGCAAGTGACTCTGGTGGAGCATGAGCCTGCACAGACTCCCGGATGGAAGCTGATTGGGGATATTAGGAAGCTGTCAGATGAAGTTCATGAGGTGGAGCTACTCTTGGAGTCTCCTGAATTACAGAAAGCAGATTTTGAAGACTTCTCCAAACAGGAGGACAAGTTAAAGCTTATTGGCGAGAAGCAGGAAGACCTCGAGCCTCGTGCAACAGAGGTGTTGTCACGCAGCGAGACAGTTCAGTCCGCATGCGCTGAAAAGGAGTACGATGCTGTAAAGAGAGCCGCTAGCAAGTTCAGATTACAGTGGAATAACCTCAACCAGGATTATAAAGCTCGTTCGCTTCGCTGGGAGAAGGCAGTAGCGGTGTGGAGACAGTTCCACTGTGATCTTAAAGACGTGACGTCATGGATGACGCATGCGGAGAAGGTTCTCGATGACACATCCGGGGAAGTTGAATTCAACTCCGCCAAAAAGGAACAAAAGGGACTGGAAGATGGCATCGCTCGCCATCAGAGCACAGTGAATGTCATGAACACCGGCGGACAAGAGATTATCAGTAAATCAACAACTGTGGAGGCTGACATGCTCCGTGATAAATTAGCCACACAGAACAGGCGCTGGGAGTCCATCTGTAATCAAGTCACAGACAGGAGGGATAGATTCAAGGAGGAAGCCATGCAGATAGAGGAGTTCTTGGAGGAGAGCAGAGACCTGCTGCAGTGGATGGACGAAGCGGACACTGAACTGCAGACCAAGGATCCATCACCTGCTGATGAGGATGGATTAGAGGAACTGCTTGATAAGATCAAGAGTATTCAACAGGAGCAAAACAACAGAGAAGATTCAAAGAACAGCATCCAACAGACAGCGGAACGACTTCTGTCCAAACCCACTATCTCCAAACCCAACTCTGAAACCATCAGAACGAGGCTGGACATCCTGCTCACGCGCTGGGACATCCTGCGCGCAGATGTCGCGACACGCACGCGAGGAGTGGAGTCCAAACTAAGACGCGTGTCCGAGTTCCTTGGGGATCTTGAAGAGCTAAGCTCGTGGGCTTCGACGACAAGGGAATTGTTGGAGAAACAAGAAAGCGGAGGCTACAACCAAGAAGTTGTCGATCCTAAGACTGTTCAAGAGTCGCTGAAGTCTCGTCAACCGAAGCTTGACACCATGAATGAAAGCATGGCGCGCTACAGACGCGAAAGCAAACTCGATGGGAACCAGGTCCCCAAGCCACTGGAAGTCAAGGTCAAGGCGCTCAACGATGACTGGAGCCGAATTGCGTCACTTACCGCCAATCTGTTCGCGGCCCGCGTCAAGCCACGTAAAGTTGTCGAGGAAACTGTTGTTGAGTCGAAACAGCGGTCAGTTCATGCTGGCGTACCACTTATAATGGAGGACTGGAGAGAGGAGCACGCATCTCCATGGCCGAAGTTCGATAAAGCAGTGTCTGAACTCCATGACTGGTTAGACACCTTGTCGGAGATGATGAAGACGGAAAAGATTGTGCTCGGAGATTCTGAGGACATGGATGGACTTCTGGAGAAGCAAAAGTCAATAGATGATCAGCTGCAAACCAAACAGCATTTGTTGGACGAGATTGCAGAGATGGGACAGACGCTTGCTGACGATGCACAAACTGAGGAAGACAAGTTCTTAATTGATAGCAAGGTCAGCAAGTTAAAGGGACATTGGGAGAACATCGTGGACAACTCGGGCGTGTGGCGAGGACAAATCGATTACTTGATGGAAGAATGGAAGAGATTCGTGGAGCTTCGCGAAGAACTTCTCGAGTGGATCCGGAAAGCCGAGGCTTATCTCGAGAGAGACGAGAACGTGTATGGTTACACGGTCAGCGAATTGGAAGAACAGATTGATAAGCACAAGGAGTTCGAAGATGATGTGGAAAATTGGCGAGGCAGTATCAGCGCCGTGAACCAATGCGGCGAACACTTGGTGCAGGAGTTCCCTCATTACGAATCTGGAGAACTGAAAAATTCCATGTCAGAGGTCAACGAGAGATGGACTAACATCACCTCCAGATCTGACTCTCGTAGGAAGCACATAAAGGAAGCATTTGATCGCATGGTGCGATTCCACGAAGACATGATCAACGCTCTGACATGGCTGACGTCAGCCGAGTCTAAAGTGGCGGAGCTGGACAGCGCTGTAGAAGCAACAAGTACAGAGGAACAGCAGGACATGGAAGCTCTCAGAAAGGAATTAAAATACCTTGAAGATGACATCAATGCACATCAGGAAATGTTTGCCTCGCTGAACGAGAACGGTCAACTGATTATGACCGAGATGGAGCCTGGGGACGTGTTAACGGCAGTGCAAGCCAAACTTGATGACATGAATGACAGGTGGCAATCACTCAACGTACGCACGCTGGACATCCGTGACCGACTGGAGGACACTGGTACCGAGTGGCGGCAGTTGCTGATGGACTTACAGGAGATCATCGATTGGATTGCACGTGCTGATCAGGAGCTAACTCTTCAGCAACCAATAGGAGGAGACCTTGAGAGCGTGCAGAACCAGAACGAGATCCACCAGGCGTTCAAAGGCAAACTTAATGTAAGGCGACTGGTAGTGGACCGAGCACTAGACTCTGGCCAAAGAGTTATGGAAGAATATGAAACAGACAGATCCGCTGACGAACCAAGGGATTCACCGCGGGCTCGCATTACACAGAATCTCAAACGGCAGATCGATACTGTTAGTGAACGCTGGGCAATGTTGTGCCAGCGATCAGAAGATTGGCAACAATGGATTGACGAGGTTCTCAGGAAGTTGCAGCTGTTCCAGGGCCAGATGGAGGAGATAGACGTGCGGCTGGTTGAGGCCGAGCAAGTCAAATCGAACTGGACACCAGTGCAGGATCTTGTCATAGATTCGCTGTCAGAACAGATGGATGACCTCAAGAATCTTCAGGAACGAATAGCGTCTCTTCAGAATATGTTCGAGACTCTCAGCAGCACAGAAGGCGAGCTGAGACGAAAGGGCGTGTCCCTCTCGCCAAACCTGCAAAACAGGATTGACCAGTTGTACCGGCGATGGAAGCAGTTGCAAATTCAACTGTTGCAGAGACAACACGCCATGCAAGAGGCGTACTCAAGCTTTGACATGTCCTCCGTACAGGGACTGCAAGCGAGTGTCGAGCCGCCCTGGGAACGAGCGGTAGCACTGAACAAGGTTCCTTATTACATCAATCATAAGACGGAAACAACGCAATGGGATCACCCGAAAATGACGGAACTTTACCATCAAATCGCGGAACTGAATGACATCAAGTACAGCGCTTACAGAACAGCTATGAAGCTGCGTTGCATCCAAAAGGCTTCCAATCTGGACTCTGTGAGTCTGACCAACGTCATTTCAGCTTTGGAGCAGCACAATCTAAAGCATGCTTCTAATGAGGCGCTTATTGGTGTCCCGGAGATGGTGAAGGTACTGACGACTGTCTACGAGAACATTGAGGTACCGCGGATTACACGGTGA

Transcript

OS493_009735-T1

Protein

OS493_009735-T1

MSEVDRVVEKCYHVLEGTEVELEDALRNLNRHAGTIKESGPGSVPDLARQLTSKRIAVTVIRKDMDDYEDRMSDIRGKVDKTRQVLEGEIQRRQQMKKDFETIRMWVVKIEVLINSKLTKHEEIDEREIKALEEEFSLNQSLVNSVESTCNELSKTPKGSAYLKLIKELEQLRAKWMTIHTKFEELKEQPGKKLEADFDTLHGQTLTDLDKIQRGVKKLKLESAEPRNIKSLLDKCLSYKDELSTIKKDLEQVRKLGFQIMERAPEEKRTGVDRRVEEVVHEHRELEKKVRTKEEAFREALPLAERLESDMSNLENWLEDKTSDVKRREEAGFPEDVDAEIKWNRGLVQDVTGKMSDVQQLTQVGRELVDLSETGQLENLEDRLTRINNAWEDLSSAAEQRMTTLPKYKAKLADFEKSVDQMNQWLEDMEKETNKVHPKEEEVDLAKNKIDEIQESIKNREPQLDLIRKQSGEFVHRGRQIMEPYKRLLDRRWEDLSSRIGQLEEELEDTKKKAEEARAKGGRVETEIIVTERKTVSSTPGGLIEEFLSREERTETDSGQPIIETITTHRTYTTNTAPDSSRYVDDDFQRRLDQILLDVKDLEDLINDIQSPKKTTENEVNEKIKVAENQVDNLQPRVEHLLKESKTLANREGARGDHIHQSLLDLSSRWLKACDEVDKQKKAIRIVPNWYQFRSNLDDIDGWLKKMEQGTELEVQPEEIEEQQAKYEMVFKNIEELDRQGVQILRCYLLPHHSSHTGDVKDAGTQSNVSVALFGEKGKSSKLRLDKSETYNTKFYRDQLDIFTVYNVPHLGDLHKIQVWHDGTGHKPDWFVKGFYIEDKSTRKVYFFNCNAWIGRDADMQDIKCEGYTLPEEGEDVMTKSSLARVRWQVTLVEHEPAQTPGWKLIGDIRKLSDEVHEVELLLESPELQKADFEDFSKQEDKLKLIGEKQEDLEPRATEVLSRSETVQSACAEKEYDAVKRAASKFRLQWNNLNQDYKARSLRWEKAVAVWRQFHCDLKDVTSWMTHAEKVLDDTSGEVEFNSAKKEQKGLEDGIARHQSTVNVMNTGGQEIISKSTTVEADMLRDKLATQNRRWESICNQVTDRRDRFKEEAMQIEEFLEESRDLLQWMDEADTELQTKDPSPADEDGLEELLDKIKSIQQEQNNREDSKNSIQQTAERLLSKPTISKPNSETIRTRLDILLTRWDILRADVATRTRGVESKLRRVSEFLGDLEELSSWASTTRELLEKQESGGYNQEVVDPKTVQESLKSRQPKLDTMNESMARYRRESKLDGNQVPKPLEVKVKALNDDWSRIASLTANLFAARVKPRKVVEETVVESKQRSVHAGVPLIMEDWREEHASPWPKFDKAVSELHDWLDTLSEMMKTEKIVLGDSEDMDGLLEKQKSIDDQLQTKQHLLDEIAEMGQTLADDAQTEEDKFLIDSKVSKLKGHWENIVDNSGVWRGQIDYLMEEWKRFVELREELLEWIRKAEAYLERDENVYGYTVSELEEQIDKHKEFEDDVENWRGSISAVNQCGEHLVQEFPHYESGELKNSMSEVNERWTNITSRSDSRRKHIKEAFDRMVRFHEDMINALTWLTSAESKVAELDSAVEATSTEEQQDMEALRKELKYLEDDINAHQEMFASLNENGQLIMTEMEPGDVLTAVQAKLDDMNDRWQSLNVRTLDIRDRLEDTGTEWRQLLMDLQEIIDWIARADQELTLQQPIGGDLESVQNQNEIHQAFKGKLNVRRLVVDRALDSGQRVMEEYETDRSADEPRDSPRARITQNLKRQIDTVSERWAMLCQRSEDWQQWIDEVLRKLQLFQGQMEEIDVRLVEAEQVKSNWTPVQDLVIDSLSEQMDDLKNLQERIASLQNMFETLSSTEGELRRKGVSLSPNLQNRIDQLYRRWKQLQIQLLQRQHAMQEAYSSFDMSSVQGLQASVEPPWERAVALNKVPYYINHKTETTQWDHPKMTELYHQIAELNDIKYSAYRTAMKLRCIQKASNLDSVSLTNVISALEQHNLKHASNEALIGVPEMVKVLTTVYENIEVPRITR

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O97592	Dystrophin OS=Canis lupus familiaris OX=9615 GN=DMD PE=2 SV=1
P11532	Dystrophin OS=Homo sapiens OX=9606 GN=DMD PE=1 SV=4
P11533	Dystrophin OS=Gallus gallus OX=9031 GN=DMD PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001553 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09068 all species →	EF-hand_2	EF hand	Domain	Interproscan
PF01477 all species →	PLAT	PLAT/LH2 domain	Domain	Interproscan
PF00397 all species →	WW	WW domain	Domain	Interproscan
PF00435 all species →	Spectrin	Spectrin repeat	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015153 all species →	Domain	EF-hand domain, type 1	Interproscan
IPR001202 all species →	Domain	WW domain	Interproscan
IPR018159 all species →	Repeat	Spectrin/alpha-actinin	Interproscan
IPR001024 all species →	Domain	PLAT/LH2 domain	Interproscan
IPR036020 all species →	Homologous_superfamily	WW domain superfamily	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR036392 all species →	Homologous_superfamily	PLAT/LH2 domain superfamily	Interproscan
IPR002017 all species →	Repeat	Spectrin repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11915 all species →	SPECTRIN/FILAMIN RELATED CYTOSKELETAL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0030864 all species →	Cellular Component	cortical actin cytoskeleton	Interproscan
GO:0042995 all species →	Cellular Component	cell projection	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009735-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009735-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

31.4Max TPM

14.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.08	19.25
polyp at pH7 6	18	18	13.05	22.96
coral polyp · control treatment	16	16	17.41	27.13
coral polyp · oil and dispersant treatment	16	16	16.15	25.66
coral polyp · oil treatment	16	16	13.72	28.62
coral polyp · dispersant treatment	16	16	20.52	31.42
Polyp	10	10	4.34	10.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.16
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.60
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.53
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.51
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.50
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.43
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.04
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.93
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.87
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.78
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.25
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.55
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.03
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.93
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.33
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.96
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.08
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.12
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.16
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.23
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.29
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.73
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.47
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.17
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.02
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.63
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.46
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.21
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.01
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.13
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.42
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.23
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.17
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.14
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.56
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.62
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.66
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.38
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.08
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.19
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.66
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.13
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.78
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.52
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.35
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.65
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.61
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.05
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.91
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.43
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.86
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.80
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.71
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.10
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.39
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.48
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.47
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.06
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.93
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.77
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.74
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.14
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.43
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.42
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.76
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.15
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.08
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.87
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.87
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.46
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.82
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.89
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.57
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.30
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.33
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.44
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.32
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.67
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.84
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.89
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.61
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.43
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.47
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.80
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.92

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.