Gene detail

Detailed information of OS493_009815-T1 in Lophelia pertusa

Genomic Location: scaffold_23:2937783...2948242
NR annotation: KAJ7363653.1, U3 small nucleolar RNA-associated protein 14 A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009815-T1

ATGGCGTCTATCCAGGACGAACACGTGGTGGAAGTATCCCAGAATCCTTTGCCAGTTGCCAGATCACGAGGGAGAGGTTTGCACGCAAAAATGGCTGCGGAAATAGCTTTGAAAATCGCGCCAGTGCGGGACAAGAAAGAGCGCGACCAAGTTCTGGATCTCGAGACCGAGCTGAACGCAAGCGACGAAGACGTCGGGAACGATAGTGGAGATGAAGAGAAACATGAACAGCTTCTTAAGGCCATCAAGTCCTTATCATCTAGTGGAAAGAAGAAACACAAGACATCACAGCAACGATCCGAGCCAAACAAGACGGTGTCAGAGTTTCATTTAAGTGTTGTTAAAGATAGCAAGCAACAAGTTGACTTAAATGATCTCATTGGATCTTTAAATAAGAGTAATGAATATGGCAATCTCAAGAAAAAATTGGACAGTATGCAGAGAAATTCTGGCACTCTTGATGTTCCTTTGCCAAAACCAGAAGCACAGAAAATTCAACGCACAATTGCATATGGAGAAACCAAAAAGGATATTGACAAATGGGCACCAACTGTCAAAAAGAACAGAGAGGCTGAACATCTGTCATTCCCACTCAAACCCTTTGAACCAACTAAACCAACACTCCGAGGATTAGCAGTGAATTTTAAGCCACGTACTCCTTTAGAGCAAGAAGTTGCTGCAGTCCTACGAGGCAGTGCTCATGTTCTTGAGCGAAGTAACAAGGAGCTGACTGAAGAAGAAGAGAAAGCTCTACTGACGATGGACTTGGAGGAGGCAAAGGAGAGGAGACATGAACTTCAGAAGCTGCGAGCGCTGCAGTCTTATTATGAAATAAAATGTCACAGGATGAAGAAAATCAAGAGCAAAAAGTATCATCGGGTGAAAAGGAAAGCTGAGAAACGTGCAGCTGGGAAGATGGCAGGAGAAGATCTTCAGAATGAAGATGCAGAGGAGGCTTTAGAAAAAGCTGAAAGAATGCGGGCCTTGGAACGCGTATCACTGAAGCATCGCAATACTTCCAAGTGGGCAAAACACCTGATTGCTAAAGCAGGCAAGAATGCAGATGCCAAGAAATTAATACAGGATCAACTGCGTATTAGCAGAACCTTAACAGAGAAAGCCGTGGAGTCGGAAAGCGATGAAGAGATGGAAGCACCTGCACACGCTGGAGGCGTGGAAGACGATGAAGACAAATCAGATATGTATGGAAATCTCTTAACCTCTGAAGACAATCCTTGGAAGTTACACACAAATGGGACACGTCATTTGCCAGAGACTTCCTCAAGCTTGGAAAATGATTCTTCAACCAAGCTCCATCGCCTTCAGCCAATCAGAACAGAGGAGGCAAAAGAGAATAGCGATGAAGATTTGGAGCACACTGCTGCTGTGGAAGAAGAAAGCGACGATGAGTTTGAGTTACAACCTGTCAGCCTCGCAGAGAAAACAACCAAGAAGTCAAAGAAACTACAAGGAACAAAGACGAAACGAAAGTCTGACGTAGAAGAAGTAGAAGTGACTGTGAAGAAAAGTAAAAAATCTGAGAAATCTAACAAGACAGACTCTAAAAAGACTGCTAAGGAAGGCAAAAAAGCTGGCAAGAAAAAGCTTGCTTCCAAATCCAAAGACAAGGTTGAAAGTTTACATGTAACTGGAGACACAATTGAAACAGAAAACACTGATTCAGCAAATATGGACATCAGTGGAAGCAGCGACAATAAAATTAATCGCAAAGAACATAATGTTGAAAGAGAAGCTAGCAATGAAACGGTGATTTCAAAATCAAAAGACATTTGTGTGGACCCAAAGAAGATTTTTAGAATCGAAGACCATGGAAATGAAGTTCAGGATGGAGAAAGTTATTCCATTCAACAGAAAAGAATCGACATTCAGCAAGCATTCGCCAATGATGATGTAGCAGAGGAATTTGTGCAGGAGAAGAGCGAGATTGAGGATGCGTCCAAACCAAAGGACCTGGATCTGAGTCTTCCAGGCTGGGGGGCCTGGGCAGGAGCAGGCATTAAACCATCAGAGAAAAAGAAGAAACAGTTCACCAAGAAAGCAGACCCTGCCCCACTCCGGAAAGACAAAGATTTGTCGCATGTGATTATCAACGAGGAGAAGAGCAAGTTGTTTACTAAGAATCAGGTTTCTTCTGTGCCGTATCCATATGGCAATCCCGTGCTATTTGAACGGAGCATGCGCAATCCTGTGGGAAAACACTGGAACACAGGCACAACTGTCGATCAACTGACAAAACCACGCGTGTCGACCCTGATTGGTACGATTATTGAACCAATCAAAGCGACCAAACAAATCAAGCGGTACAAGCCCGAGAATAGGAAAAGGAACAAGAAAGGGAAAGAGTCTTCAGGAATTACAATTCACAGTTGA

Transcript

OS493_009815-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q640M1	U3 small nucleolar RNA-associated protein 14 homolog A OS=Mus musculus OX=10090 GN=Utp14a PE=1 SV=1
Q6EJB6	U3 small nucleolar RNA-associated protein 14 homolog B OS=Mus musculus OX=10090 GN=Utp14b PE=1 SV=2
Q5TAP6	U3 small nucleolar RNA-associated protein 14 homolog C OS=Homo sapiens OX=9606 GN=UTP14C PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004882 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04615 all species →	Utp14	Utp14 protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006709 all species →	Family	Small-subunit processome, Utp14	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14150 all species →	U3 SMALL NUCLEOLAR RNA-ASSOCIATED PROTEIN 14	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0006364 all species →	Biological Process	rRNA processing	Interproscan
GO:0032040 all species →	Cellular Component	small-subunit processome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14567	UTP14; U3 small nucleolar RNA-associated protein 14	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009815-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

98.8Max TPM

48.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	45.35	72.78
polyp at pH7 6	18	18	46.37	91.34
coral polyp · control treatment	16	16	52.95	88.90
coral polyp · oil and dispersant treatment	16	16	55.06	94.22
coral polyp · oil treatment	16	16	52.60	90.61
coral polyp · dispersant treatment	16	16	31.53	51.71
Polyp	10	10	58.84	98.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	72.78
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	72.24
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.76
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.08
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.72
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.64
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.71
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.01
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.50
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.13
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.37
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.33
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.13
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.06
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.13
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.66
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.34
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.45
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	71.65
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.33
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.59
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.39
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.33
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.76
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.76
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.19
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.25
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.30
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.72
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.31
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.70
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	88.90
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.99
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.93
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.59
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.33
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.23
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.08
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.43
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.19
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.34
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.15
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.99
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.20
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.22
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.28
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.82
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.43
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.89
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.32
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.53
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.05
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.98
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	90.61
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.72
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.95
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.80
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.09
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.91
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.39
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.10
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.39
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.81
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.99
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.56
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.73
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.26
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.09
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.36
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.87
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.26
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.59
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.93
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.17
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.50
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.98
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.27
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.74
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	98.85
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	80.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	78.41
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	71.95
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	65.38
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	58.55
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	43.48
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	35.59
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	32.07
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	23.30

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.