Gene detail

Detailed information of OS493_009821-T1 in Lophelia pertusa

Genomic Location: scaffold_23:3003653...3010754
NR annotation: KAJ7363659.1, Chromatin assembly factor 1 subunit B [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009821-T1

ATGAAGCTAGATACTCCAGAAATAGCTTGGCATGGAAAAGAACCGATCTTGAGCGTCGATTTCAGCAAAATAGGATCAAAATGGCGACTTGCTTCCGCCGGAGCTGATAACGATGTCAAGATTTGGTCGATCGTTTCCAGTGAAGATCATACTGAAATCGAATTCTTAGCCAATTTGAGTCGCCATACAAAGGCTGTAAACGTAGTGAAATTTTCACCAAAAGAGGAAATTCTAGCGTCAGGTGGAGATGACTCTATGATTATTCTGTGGAAGCTCAATAGTTCCGCTGATCAGAATACTAATGACATATTTATGGATACTGATGACGTACAAAACAAGGAATCTTGGACATTTCACAAAGCCCTGAGAGGCCATATAGAAGACGTGTATGATCTCTCCTGGTCACCAGATGGCAACAGTCTCATCTCAGGATCTGTCGACAACAGCGCTATTATTTGGGATGTTGTAAAAGGTCAAAAGCTTGTAATTTTGAAAGACCACAAACATTATGTCCAAGGAGTATGCTGGGATCCACTTGGTCAATATGTCGTAACAAATTCAAGTGACAGAAGTTGCAGACTTTACAATCCCAATTCATATCGCTGTTGTTACAACATCACTAAGCTGTTGGTGAATGGATCTCAAAAGACAACAGAAAATGGAGAGTCATTCAAGCAAGGAAAAATGTTTCATGATGAGACCATGCCATCCTTTTTTCGCCGACCGAGTTATTCGCCTGACGGTTCTTTGCTGCTAGTCCCAGCTGGCCGACTTGACGTTGGTGATCAGGTGGTCAATACAACATATGTCTTCACTCGTGGATCGCCTAATAAGCCAGTGCTCTATCTTCCCAGTCCTCAAAAGGCCACTGTGGCCGTACAGTGTTGTCCCATCCTCTTTGAACTAAAACAAGATAATGCTAATAGTGAAGACAAGTCTACAACAAGTCTCTTCAAGTTGCCTTACCGTATGGTATTTGCCGTGGCAACACTGGATTCAATCTTGTTGTACGATACTCAACAAGCAACTCCATTTGCATACATTGGCAATATTCATTATGCAGCTCTAACGGATGTCACATGGTCCAATGATGGAAGCATGCTCGTCGTTTCCTCTTCCGATGGTTACTGTTCCATTGTTCACTTCAAAGAAGGAGAGCTTGGCGACCCTTACAACCTGTCAGTCAAACAAGTGTTGGAAAGAAGCAGCTCACCATTGCCGCAGAACTCCGATGCTCCAGGTAAACTGAGTAAGAAAATTACATCAACCCCATCTGCAGAAAAAGACGGCAATGAGGAAAAAGTGGACAAACCTCAATCTACCAACAAGAAGGAACCTGTTGGCCGGATTAGTATGTTTACTGTGCCAATGAAAATCACACCTACTAAACCTGTTAGCAAAGTAACTCCAAAAAGAATCGCATTGACGCCAGCTCCTCTAAAGCCACCAGTCGTCAATCCAACTTCAACAGAATCAACTGCGCAGACCACCCAGTCAGTTACAAGCACTGGGGGACCAGCTGCTCCCAAACGGGTGACGTTAATGCCAGTTCAAGGGCAGTTAAATGCTGGCAATTCTTTGGTGACAAAAAGAATCTCACTGACGCCAGCTCCTTTAAAGTCACCAGACGTCAATCCAACTTCAACAGAATCAACTGCGCAGACCACCCAGTCAGTTACAAGCACTGGGGGACAAGCTGCTCCAAAACGGGTGACGTTAATACCAGTTCAAGGGCAGTTAAATGCTGGCAATTCTTCGGTGACAAAAAGAATCTCACTGACACCAGCTCCTTTAAAGCCGTCAGTCGTCAATCTAACTGCAACAGAATCAACTAGCCAGACCATTCCAAGCCCTGCACAGACAACCCAGCCAGTTACTAGCACTGAGGGATTGAAGCCATGCCCAGCTGCTCCCAAACGAGTGACGTTAATGCCAGTTCAAGGACAGTTAAGTGCTGGCAATTCTTCAGTTACAAATGGAACTAGTCAGATTATGCCGAGACGTGTCCCACTTATGCCAGCAGGAAACAGCCAATCAGATAAAAACTCTGATGAAAACAAACCAACAGCCCAGGTAGCTCCAAGGCGTGTAGCTCTGACACCAGTAGATAGTACAGGCATCGCAAACAACACAGCAACCAAATCGCAGGAACCAAACTCAGTTCCTGGACATGTATCGTCCAGTGGGGATGCACCTTCCGTCTCTATGACATCTTCAGGCGATAATGGAACTAGAGATACCAGCCCTATGCAAACATCCACTCCACCTCAAACCATACCTAGTACTGCATCAAGAAGAATGCCGCTAACCACCCTGGTAACTGATGTTGCCGAGGGCTGTACAAAAGGATCGGCACTGCCAAGCCATTCCACATCTGTTGATCAAGAAGTTCCTCAGCTAGTGGTCAAAGAAAACACAAAGTCTTCTGTGACACAACCGACTCCTGTAGAGAAACCTGATGCGACTGTCTGTGTCAACAGCATTCAACCAAGAAGAGTAGCGCTGACACCTGCTCCGATGGAAACCCAGTCGTCTGTTCCTATGGTAACCAATTCATTATCCATAACGTCTCTCGGTGATAAGGAAAATAACAAAATTAATCAATGTCCAATCGCTAACGATCCACCGCAGCCCAGAAGGGTAACGCTTACGACTCTTGGAAGTGAGAATACCCACGTTGAGCAACTGCAAAACAGCTCAAAGAAGTGCCAAGCCCCCAGAAGGCCTATTCCCTTAGAACCTAAAGTTATTGTGTTGGATGATTAA

Transcript

OS493_009821-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9D0N7	Chromatin assembly factor 1 subunit B OS=Mus musculus OX=10090 GN=Chaf1b PE=1 SV=1
Q5R1S9	Chromatin assembly factor 1 subunit B OS=Gallus gallus OX=9031 GN=CHAF1B PE=1 SV=1
Q13112	Chromatin assembly factor 1 subunit B OS=Homo sapiens OX=9606 GN=CHAF1B PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005167 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR045145 all species →	Family	Chromatin assembly factor 1 subunit Cac2/CHAF1B/FAS2	Interproscan
IPR001632 all species →	Domain	G-protein, beta subunit	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15271 all species →	CHROMATIN ASSEMBLY FACTOR 1 SUBUNIT B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006334 all species →	Biological Process	nucleosome assembly	Interproscan
GO:0006335 all species →	Biological Process	DNA replication-dependent chromatin assembly	Interproscan
GO:0033186 all species →	Cellular Component	CAF-1 complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10751	CHAF1B; chromatin assembly factor 1 subunit B	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009821-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

10.4Max TPM

2.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.99	6.55
polyp at pH7 6	18	18	3.58	7.25
coral polyp · control treatment	16	16	1.80	10.40
coral polyp · oil and dispersant treatment	16	16	1.05	7.17
coral polyp · oil treatment	16	16	1.31	3.22
coral polyp · dispersant treatment	16	16	1.05	2.32
Polyp	10	9	2.22	6.05

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.55
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.92
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.06
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.94
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.52
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.16
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.96
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.19
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.01
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.98
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.58
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.41
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.80
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.25
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.85
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.13
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.09
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.67
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.65
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.12
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.85
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.36
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.92
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.77
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.67
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.22
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.48
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.35
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.23
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.17
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.47
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.23
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.96
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.81
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.76
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.76
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.51
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.37
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.17
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.21
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.19
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.99
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.78
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.60
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.38
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.30
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.26
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.22
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.17
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.20
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.16
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.46
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.40
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.38
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.06
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.83
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.64
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.52
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.51
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.32
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.53
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.52
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.48
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.25
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.94
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.75
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.61
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.42
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.24
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.05
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.69
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.24
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.02
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.37
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.20
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.31
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.29
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.