Gene detail

Detailed information of OS493_009822-T1 in Lophelia pertusa

Genomic Location: scaffold_23:3011131...3031962
NR annotation: KAJ7363660.1, metal ion binding [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009822-T1

ATGCAGCGGACACCAACTTGCCAGAATTGCTGTAAGAGTTACGGCTTTAAAGATGTCTCCAAGCCTATTGGTAACCGCATCCCACTATTATTGGAATGTGGCCACACCTTCTGCGAGGGGTGTGTCACCAAATGGGCCAGATTACAGAAAACACAGATACTGTGTCCAACATGCACGCACTCTACCACCCTGACAGTTGAAGGAGAAAAGGGGGTGAGGGACATCTCACCCAATATCCACTTGTTAGGGGTAATGACAAACACCAAGAGAGCTTCTTATCGCAGCGATGTTCAAAAGTCTGGTCGTTCTAAGCTTGGAACTAAAGCAGGCCTTCAGAGAGCGATTAGTCAGTTTGCACAGGAAAAGAAAGCTGAACTAATGAAAATCGACACTGGTGTGAAATGTGAGGAGTGTTCCAGAGGAACGGCAACAGCCAGTTGCAATAAGTGTGAAACTGTGTACTGCAGTGCTTGCTTCGAGAGGGTACATTCATACTCAAATGCATTGCGGAAACATGTCTCTTCGCCTGTTACACAGACAAACAGTGAAACGGCTGTTGGTTGTCCTGATCACAACAACAGACCTCTGGAGTTTTATGACAAGGACGATAGTCAGCCTGTGTGTTCACACTGTGTGGTTGTGGGAGAAAGACAGATGCATGCCATTGTTCCCATTGATGAAATTGCCAAAGAAGTGCAAGTTCAGTTTAAAACGTCAATTGAAGAAGTTACTCCAATAATCAAGCAACTGGACAAGTCAGTGCAGAAAATTTGTAAAGCACTTCCCGAGGTTAAGGCTGAAAAGAATCACATTGTGAATGATATAAGGGAGCACTTTCAGAATGTATATGCTGCATTACAGACAAGAGAACAATCACTGATCAAAGATGTTGAATTAAGCCATAATGGTGAAAAGATTCTGGAGACACTGCGTGAAGAAGTTACAGATAGTTTACGAAAGGCAAAAAGTTATGTTCAAGATTTGGAAAATATGATTGGACAGCCACAGAAATTGATTGATAATGCAAAAAAGTTAAAGAGTGATTTGGAGAGTGTTCAGGAAATGTCATGTTGTGCAGTGGAAGTGCCTTCACATGGAGATGACGTGAAGTTTGAAGCGAGTAAAGAGTTACAGAACAGCATTTCAGAATATGGTTCGGTGTCAATGGATGGATGTACAAGGTTTGAGCTTAAAAAACTGAGTGAAATGAGCGAGGAAGACTTGAGAGAAGTTGATAATGATGACGATTCAGAACACGAGCTCGCTGAGGCCCTGGCCCTGCAGGATCAAGATCAAGTTGAAAATACAGATAAGTCTGGTGATAAAGTGCAACATGTGGGAACAGCGAGATCCATTACAGCTTCCAAGATACTCAAAGCAAATCTTGCATATCGACATGAAATGGTGTTGGTGACACACATCCGAGATCCCTGCCAGTTTATGATTCAAAGAGTTGCAGACATGGAACAACTCCAAATCATGATGAATGTCATCAACATCTACTGCGACAGTACAGAAAATGTGCATGACCTCCTTTATGATGTCAAAATTGGTGACATGTGTTGTGCCCAATTCACCATTGACAATCAGTGGTACAGAGCATGCATCATAACCGCATATTCACCGGATCACCCCAATGTTGTACCAACACTGGAGAATAATCTGTGTGTTGAAGTGCAGTACATTGATTATGGAAACAGCGAGTGGCTGCCTCTTAGCAGGCTGAGAAAGATGAAAGCTGAATTTCTAAATATCCCTGAACTTGCACAGTGTTGTTCCTTAGCAGACATTGTCCCTCCATTCCAGGAGGACAAATGGCCGTCAAAGGCAACAAAGGCATTTGGAAGCCTGACAGGAGACAAACCTCTGCTAATGACAGTGATTGGAAAGAAAGGCAGCAAGCTTTTTGTCGACCTGCGTCGCCCTGAGGATGATGAACCGACTCAAGATGATGACAGACCAGTGTCTGTCCGTGATGCTCTTGTTTTCTTGGAAGTTGCTCGATTCTCTTCTCCTGCCTCAAAACCTGAAGGCCTTTTCTTCCCCAAAAAGACCTACAAAGAACCAGTGCCTATCGGAGAAGGAGCCTTTGTTGATGTGCTGGTGACACATGTTGCTGCGCCTGATGAGATTTACGTACAGAAGCTGCGGAGTGAAGAGACACGGGAGCTACAACACATTATGGAGGAAATTAGCAAGATGTTTGGTGGAAGAAGGCGTGGTACCGAGTGGAGTGTACCATGGCCTTATAAGGGTCTGGTCTGCGCTGCAAGATTTACAGAAGATAAAGTTTGGTATAGAGCTTTGGTTACAGCTGTGAACAGTGACGAGACAGTAGATGTGACTTACATAGACTTTGGAAACTCTGAAACGTTACCATTTGCCGATATCAGGAAACTACCAGATATGTTTCTTAGACTGCCAAAGCAGGCATTACCTATTTGTCTCGTGGATATTAAGCCGAATGGGGATGAAGCCGAATGGCAAAAGCAGGATCAAGTGAATATATCCAGCCTGCTGTTGAATAGATCTTTGGTGGTTGATGTTAAAGGTGTTGTAGATGACAAGATGTCTGTATTGCTGTTTGACACCACAGGCGCAAAAGACGTGTGTATCAACGAGTTTTCTTGTGCTCAATGA

Transcript

OS493_009822-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9BXT8	RING finger protein 17 OS=Homo sapiens OX=9606 GN=RNF17 PE=1 SV=3
Q4R3G4	RING finger protein 17 OS=Macaca fascicularis OX=9541 GN=RNF17 PE=2 SV=2
Q99MV7	RING finger protein 17 OS=Mus musculus OX=10090 GN=Rnf17 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003362 (this species only)
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00567 all species →	TUDOR	Tudor domain	Domain	Interproscan
PF00097 all species →	zf-C3HC4	Zinc finger, C3HC4 type (RING finger)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR000315 all species →	Domain	B-box-type zinc finger	Interproscan
IPR035437 all species →	Homologous_superfamily	SNase-like, OB-fold superfamily	Interproscan
IPR002999 all species →	Domain	Tudor domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR039117 all species →	Family	RING finger protein 17	Interproscan
IPR018957 all species →	Domain	Zinc finger, C3HC4 RING-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16442 all species →	RING FINGER PROTEIN 17	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18405	TDRD1_4_6_7; tudor domain-containing protein 1/4/6/7	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009822-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

20.2Max TPM

5.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.99	11.98
polyp at pH7 6	18	16	6.30	11.21
coral polyp · control treatment	16	16	6.95	20.20
coral polyp · oil and dispersant treatment	16	16	4.33	17.66
coral polyp · oil treatment	16	16	5.95	10.82
coral polyp · dispersant treatment	16	16	6.63	14.03
Polyp	10	8	3.19	9.06

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.92
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.04
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.72
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.12
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.33
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.51
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.13
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.11
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.86
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.53
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.51
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.48
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.45
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.23
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.11
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.69
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.09
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.26
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.85
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.52
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.76
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.20
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.29
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.07
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.62
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.21
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.20
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.10
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.87
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.79
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.46
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.99
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.35
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.42
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.16
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.66
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.88
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.45
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.25
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.03
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.45
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.97
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.49
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.14
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.92
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.82
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.96
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.58
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.19
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.87
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.76
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.57
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.53
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.54
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.08
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.42
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.97
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.15
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.00
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.67
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.17
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.28
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.24
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.26
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.08
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.99
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.27
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.06
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.95
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.55
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.11
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.59
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.31
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.