Gene detail

Detailed information of OS493_009823-T1 in Lophelia pertusa

Genomic Location: scaffold_23:3032757...3041055
NR annotation: KAJ7363661.1, gamete proteinration [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009823-T1

ATGTCTCGGCCACTCGCATGCTCATTCAAGCGTTCTTGCAGCATTGTAAAGAGCCGAGATGAACTAACCGCTGAAAGTGCCGAGAACGCAGCAAAGAGCAAAGAACAAGAAACACAACAGGAACAAACAGAGAAAGACACAGACAGTCTACACGAAGGTTCAACTGAGCCTGAAGTTCAAGACGAACAGTCTAGTCAGACGAGTTCATTCACAGAAGAAGAGAAAGTTTTATCTGAGGAGAAAGTGGACTCGCAAGCAAGCGAAGCACCAGCCGGCGCTCCTGAGGATTATAAAGAGTTGCAGTACAAGCCGGCCACCATCCCGCAGAGGAATCGATTTCAAGCTGGCATCACATTTGTGGATCCTCAAGGTTATGTTTATGCTCAAGAAGTGAAAGAAGGGGACCGTACGTTAATAAACATTATGGGAACCCTGTTAGAGAGGTACGGTAAAGGTGAAGACCTGTCAGGCGCTCCATCTGATGCCACATCAGTGTTCCCAGGCCTCCCCTGTTGTGCTCAGTTCACCGAGGATGGCATGTGGTACCGTGCAAGGGTCGTAAAGTTTGTGGAAGAAGAAAAAGTGGAGGTGAACTACATTGATTTTGGCAATTCTGAGGTGGTGTCCCTGTCGGCGATAAGACAAGAGATGCCATTTATGGAAGTGCCACAGCAGTGTCTTCAGTTGGTGTTACGCGGTATTGAACCAAAAACCAGTGATGGTCACTGGCCTCCCGAAGCCATCCAAGCGCTGTCTCAGGCCATTGTTGGTCAGGACTGTGTAGCGAATATCAGGGGTGACAAAGTTCCTGGCTACCCACTGGTCGTGAAATTGTTTCTTCCCGATGGCTCCGACGTGGCGCATACTTTGTTGAGTAGGGGCCTGGTGCAGAGATCTTCGCAGCTTGAAGAAGAAGAAGAGTCTCCCCAGTTCTACCCGAGAAGGAGAGGGCCTGGTAAATCCGGGCCAATCACGTCCAAGCGATCAATTACTGAAACCAGAGCGCATGCTGAACAGATCAGTTCACGAGAAGCTGAATGTATGCTGGCTCACACCGAGCTCCCTGGGGATGGCATCCGCTTTGACGTCACCATCACCCATATAGAACGACCTGACTGTCTGTTCATCCAGCGGGTTCCACCCACAGAGGAGGCCAGGGGGTACTCTGATGATCCCGACCCTACCCTGGAGGATGCAGCTGAAGAGCTTCGTACGCTGGAGGAGATCATGGCGAAGATAAATCACGCGGATTACTTTAAGAAGTACACTCCACTGGCGACTGCTAGCGAAGGAATGTTGTGTTGTGCGCGTTACACTGAGGATGATATGTGGTACAGGGCTCAGGTCAAATCAGTTGAGCGTCAGAAGCCGCTGGAGGTACGGGTACTGTACGTGGATTATGGCACTACTGAAGTGATCAAGGCAGACAGGTTGCGAGGTTTTCCCTCGGAGTTGCTGGATTTGCCGGTCCAGTCCACGCGTTGTTTTCTTGCTGACATCAGGGCCCCAGACACCACAGACAGACCAATGATGGATGATGGATGCTGGCCTGTGGACACCATGGAGACTCTCATTCAGTTTGTGGCCGGCAAGAATCTCGTGGCAAAAATGCTGTTCAGTGGTCCGCCCGCCAGTGTGATGTTGTACGAACATAAAGCGAGAAGCGACGGATGTACCGAAGAAGTATCGATTGGGCTGCTGCTGGCACAGAAGGGCCTGGCTAAATATGCGGATTACGAAAAAGGCACACACGAGGAGGAATCAGACACTAATGTGGAAGGGAGCTGTGAATCTGAGGAAAAAACTCTGGAGTTCCAAGAATCGAAGCTAACATTTACATCGGCTGGGTCAGAAACTAGCGCGGAATCTAAAAACTCTTCTTCGTCTGCGGATCTGTTGGAGAAAATTCTCTCTCCAAAAGTGAGCTTTGCTCCCGCAAAACAGCAAGTCTTAAAACCTTCGGAGCTGACAACGAAGAGCGAAGATCAAACTGCTAAGAACTGTGAGTCGGAAGAGAAGCGCACAGAACTCGGTAGCTCTTCCGTTAACTCTGAAGATGGAAACTCCTCGCCAATTCCAACGAACGCAAACACGTCACGTGACCAAGAAGAGACGACGTCACCTCAGCCCGTATCGACAGATCACGTGACCGAAGTGACGTCATCAGATACAGACTTGAGTTCCGCTGAAGTGAATCATAATTCTGTGGAGTCTTCTGTATAA

Transcript

OS493_009823-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99MV1	Tudor domain-containing protein 1 OS=Mus musculus OX=10090 GN=Tdrd1 PE=1 SV=2
A9CPT4	Tudor domain-containing protein 1 OS=Oryzias latipes OX=8090 GN=tdrd1 PE=2 SV=1
F1R237	Tudor domain-containing 6 OS=Danio rerio OX=7955 GN=tdrd6 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003362 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00567 all species →	TUDOR	Tudor domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002999 all species →	Domain	Tudor domain	Interproscan
IPR039117 all species →	Family	RING finger protein 17	Interproscan
IPR035437 all species →	Homologous_superfamily	SNase-like, OB-fold superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16442 all species →	RING FINGER PROTEIN 17	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_009823-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_009823-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009823-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

41.8Max TPM

14.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.00	26.55
polyp at pH7 6	18	18	18.25	32.21
coral polyp · control treatment	16	16	14.63	33.01
coral polyp · oil and dispersant treatment	16	16	8.95	41.79
coral polyp · oil treatment	16	16	14.28	22.78
coral polyp · dispersant treatment	16	16	11.87	20.21
Polyp	10	10	16.33	30.46

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.44
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.34
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.36
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.04
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.41
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.10
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.56
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.72
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.13
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.61
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.40
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.14
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.20
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.12
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.57
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.54
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.21
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.91
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.35
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.06
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.92
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.87
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.72
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.61
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.48
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.02
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.13
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.94
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.34
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.01
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.77
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.79
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.35
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.46
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.04
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.61
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.49
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.88
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.43
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.29
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.78
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.23
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.79
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.74
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.29
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.01
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.59
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.55
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.34
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.34
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.31
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.99
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.78
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.25
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.78
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.19
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.23
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.84
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.43
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.77
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.54
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.01
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.35
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.46
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.91
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.72
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.21
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.85
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.76
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.97
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.96
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.38
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.02
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.42
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.41
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.07
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.80
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	30.46
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	29.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	28.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	20.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.49
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.52
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.45

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.