Gene detail

Detailed information of OS493_009851-T1 in Lophelia pertusa

Genomic Location: scaffold_23:3333256...3347458
NR annotation: KAJ7363688.1, Armadillo repeat-containing protein 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009851-T1

ATGGACCCGCCGCTGACGCCGAAATCGCGCAGAGGCGAGAAGCCAAGCCGGCCGTTCTACGCGCCAGCCGTCGAGGGCCCAACGAGCGCAAATATTGTCTCAGAAGCTCGATCTTCTCTCCGTTCTTTGGACACCAAAAGGCCATTTACTCCAGTGGAATCTAACAGGACGTTGTTTGGTGGTAGTTCCGTGAAGCCGTACGAAGGAAGACCACCGTCTGCATTCAGCCTAGGTAGTTACCAGTCAGAGGGAGAATCCTCCCGTCCCCCTTCAGGAAGGAGGCTCACTCCAATAGAAAATGCGCCACATATTCCTGAGGCCGTTGTTCCTTCCCACCGTCTGGAGTGTGTGACACTTCATGGCTATATGCGATCTAAAAGCAGGCCCTCAGGGAAATCCAGGAGACCCTTTCGATCTTCTTTGTCTGGTCCTGTTGAAGACTTGAATGCCGAGAAACTCAATCAGAAGCTTGTTAATGTTGCGATAGGTCAACAAGATAGAGAAGCTAGAATTGAACTTTGTCCCTCTCCACCAAAGCGGGGGTCTCCTTCCAGCACTCCGCCCACCAGTTTGGGTGAACCTTTTCGGCGAAACTCGGCAGAAATTGTACCAGCACCACCTGCAGTGTCAAGGGATGTCATTGGAGCAAGGAGAGTTAGAAGTGGGCCAAAAGAGCGCAGTCCACCTGTCGTAGATTCTATCGCCCGTGTCAAGAGCGGTCCTCTGGAACGTGGGGATCCTACTGGAAACTCAAATGAACAGACTGTTGACGAGAGTTCACCAACTTCAGGGAGAAGGAAAAAGGGAAGCGAGAGAAATGGCAGCGGCGATAAAAGGCGGAAAAAGTCACAAATAGAATCAGAGGAGAAGCCTAAGGATGAACTAGTTTCGTATTACGAAGAGCATGTGAAACCATTGCTCTCTCAAATGGAGGAAAGGTTTGCAGAGAAGAATGCGAAGGATCTTTGTCAAGATTGTTTGAAACTGTGGCATGCGTTAGAAAAGAAAGGTTTAATTGGAAAAGCCAGTGGAAGCTTTTCTGCAAGAAGGAGAGGGGAGATTTTACGGACAATTTTTAAGTTCTTGGATCTCAATGACCCAAGGTTACTCCTGAGACTCGGCAGAGTGGCTAAAACAGAGAAAAATGATCAGTTGTTCCTTGAAGAGGACATTCTAAAATGTCTAGTAGACACATTAAGAAGCTGTGAAATAGGCAGTCATCATGATGCACTGGTATATACTGCTGGCGCTGTCAAACATCTCTCTAGTAACAATCCTACGGCTCAAAAAGAACTGGTTTCTCTTGAGTGCATAGAAGGTTTAGCACAGATTCTTGATGCCATTAGTAAAGATGTGTTGATGTCCATGAAGGGGAATTCACAATTCACCAGTTTGCTTGTTCAGATTACTGGAGCACTGAGAAATCTTGCCGATGTTACTGGAGCCAGAGAGCTTTTTGTCAGCTGTGGTGTAATTAGGAACTTGGCCATAGTTCTGGGGCCATATTCATCTGACAGTGATGTAGTCTGGAATGTGTGTCGTGCGTTAAGCAAGCTGACATTATACACGGAATGCTGCAGTGAACTGGTAGATTCTTGCACTTGGCTTCAAGCACTGTGCAAGATCCTATCAGAGTACGAAAAGAAACAGGAATTGGTGGTCCGTGTCTGTTTTATTTTGGGCAACTTAACATCGAAGAGTGAGAAAGTCAGGGAAGCGATTTTCTTTGATGAGTCCTTCATGGCTGTCTTACTGTCTGTTATGCAGACATACTTCAACTTTGAGATGGAGGTGCTAAAAAATGGACCCACATCTGAAGAAAAACAACTGAATGGAGAAAACAAAGGCCCTAACAAGAATGAAGATGTCCTGATCAAGGCCATCAGAGTAATCGCCAACCTTTCAATCAGTCCAGAAGCTGGTGCAGGTGTTGCTGCTCATGAATCATTAGTTGATCTGTTAATCCAGATTCTTGATGTGAAAGATGCAACCAATAGTGAAGAGCTTGTCCTGAACACAGTAGCGACTCTTAATAACTTGTCGTTTTACAATTACGGTGATAGTGTAATACAACAGAGACAAGTCGAGATAACTGAGATGTTGATTTCCTTGCTAATGCCTGAGAACATGGATGCAATGGTGGAAGCCAGCCGTGTGTTTGGAAACTTTTCAAGATCCAAGGAAGTGAGAGCTTTACTTGCTGAACACAAAGTTGACGAGATCATGATTGCTTTGTTGGATGCTGGTGAGAGAGAAACTGTGTTTACAGCATGCGGTGTACTGATAAACCTGATGATAGATGAGCAAATCAAACCAAAACTAAAAGAGGAGGATGGAATTAAAAAACTAGTGGATGTGTTGCGTGACTTTGGGAAACATGATTGGCAGTTATCAAGTATGGTCTGCCAGATCCTGTGGAACTATAGCGACAAGATAACCAGCTCTTCTGAAACATTTGGTGATCAAGAATCATTAGAATTGATGGATATTCTCACACAATATCTGGATGAGGACATTGTTCTTGATTCAAGTTGA

Transcript

OS493_009851-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P0C6R2	Armadillo repeat-containing protein 2 OS=Bos taurus OX=9913 GN=ARMC2 PE=3 SV=1
Q3URY6	Armadillo repeat-containing protein 2 OS=Mus musculus OX=10090 GN=Armc2 PE=2 SV=3
Q8NEN0	Armadillo repeat-containing protein 2 OS=Homo sapiens OX=9606 GN=ARMC2 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007629 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_009851-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR038905 all species →	Family	Armadillo repeat-containing protein 2	Interproscan
IPR000225 all species →	Repeat	Armadillo	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21356 all species →	ARMADILLO REPEAT CONTAINING 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0044782 all species →	Biological Process	cilium organization	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24123	ARMC2; armadillo repeat-containing protein 2	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009851-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

35.9Max TPM

8.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.16	12.18
polyp at pH7 6	18	18	7.24	10.70
coral polyp · control treatment	16	16	11.58	35.94
coral polyp · oil and dispersant treatment	16	16	10.11	33.87
coral polyp · oil treatment	16	16	9.22	13.78
coral polyp · dispersant treatment	16	16	7.29	14.11
Polyp	10	9	4.43	7.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.18
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.46
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.46
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.17
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.29
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.14
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.97
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.56
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.25
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.40
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.82
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.25
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.07
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.45
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.73
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.70
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.51
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.17
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.88
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.43
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.14
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.13
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.93
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.58
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.55
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.51
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.38
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.87
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.55
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.94
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.03
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.77
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.57
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.28
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.27
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.61
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.30
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.60
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.94
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.99
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.77
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.37
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.95
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.45
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.54
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.37
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.04
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.02
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.98
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.48
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.46
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.04
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.78
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.05
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.89
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.22
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.18
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.01
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.09
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.79
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.60
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.34
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.38
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.11
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.63
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.34
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.75
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.12
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.06
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.86
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.99
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.49
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.96
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.38
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.76
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.13
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.80
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.06
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.43
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.01
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.44
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.01
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.