Gene detail

Detailed information of OS493_009855-T1 in Lophelia pertusa

Genomic Location: scaffold_23:3376025...3401605
NR annotation: KAJ7363692.1, Mitogen-activated protein kinase kinase kinase 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_009855-T1

ATGGCGGAGGAGGACGATTCGGATGACCTGCAACAAATTACTACTGGCTCGCCATGCGATGAAATCGACCCTGCAGAACTTTTTGAAAACCAAGGAAGTCTAGAGATTGAACGAAATCGTGTGGAAGACAGGGGTTCAGGCTCCGAATTGGACTCCGAACGCGAGGAGCATGTTGGTGAGTTGTCATCGGAGAACGAAGAACTCTCCGACGGGTTTCCTTATGGAGTCACTCCACCAAGAAATGTTAGAAGACAGAAGGAAAAATCAAAAAGAGGGAAAGAAAAGGTGCAAGCGTTACTGAAGAGCCCTTTAAGCCGCGAACATGGATCTAATACTTCCGAGAAAGCTGAACAGGACAGACGGAAGAAGCGAGGTTCCACTCAACTCACGACCGAACGAGCTTTCCAGAGACAGTTCAAAAGGAGCAGTGTTGATGTGGGGCTTATAAACCTTGAAGGTGGCGCTCATTTATCAGATACTTCAAAATCTTTAGAAATTCCCAGCATCAAGATCGAATCAACAAGTCGATTCATGTCTTTGGACTGCGTTTGCGAAGATTCTACTGACAGTTCATGTGCTGTCACAGAGTCAGTTGCCATCAAACGGACTATAACCCGAGGTCATAGGAAAGCTACTCGCTCGGAATCTGACCCCCGTAGCTCATCATCTCGTAATTACCTCAATCCGTATTGTCCAGAGGCGAGAATGGAGTTCTACAGAACTTTTTCTTTGTTGATCAAGCTCGGGTCATTAGCTCATAAACAACAAGAAAAACAATATGGAACTGGTGCAGTAGAGAGGCAAAGCTCTGAAGAGAACAAGAAATGGCAGGTAGAGTTGTCGCAAGCTCTGTGGCTGGAGCTGCAGGCGTGGCATGCAAACAGAACCATGGAAGAGCAGGATCTCTACCTGATACGGGCACGCGCTGAAGTCGAGAAGGTGTTAGATGAGGTCATAAATTTTACAGTAAAAAAACAAGATGCAGACACTCAGAATATAGATGAAAAAGTTGATCAGAGCAATCAAAATGGTAATGGTGATCATTTTGTAAGAGATCCGAGCATCACCAGTGAGGACAAAATGGTCAATTGCGCAGAAAGTGACTCGGGCACATTGGCGCAATTGTCACATTCAGTTAATTCTCCAGTGCTTAACTCTTGTGAAGGAAATCAAAGTGAACATGTTGATTCCTCGCACATCCAGAATACAGAAAACTCTTTAACCAAGACAAATGCACGGCCTTCATATGAGGTAGACGGCTTTGTCGATGGTCCTACCACAAATGCAACAGATTACAGAGCCTTAAAAGGTCGTCTGTGTTTAGATTTAAATCAGAAGAACCAGAAACTTTGTGTTGGTGAAGCAGGCTTTAAACCAGGAAGAGAAACTTCGCCAGATAGAACATGTTGTCAGTTGAAAGCTGCCATCGAGCAAGTAACCGAACTGTTTGACAAGGTTGAACGGGTGGAAAATCTTTACCCCACTCGCCAGTCCTTAGGCGAACAAAACCACAAGTACACAAGCAAGGAATTCTCGAGAAACTTTGAAACAATGTGCTTATGGTTGAATGTGACAAGAGAGTTGTACCACAAGCTGCATTTGATAGCAAAGTTTGTTGGTGTGAATGCAGCCGACACACAAATGTGGCAAGATTGGCTGGATTTTGGTCTTGGAAGATTAGATAGTGTGTGTCCTGCATCTGATCTGAACCATGACGACAGTGGTGAAACTTTCTTATCATCAACTGATGATGACGAAGATGATGATGACGACGATATTGAGGATCAAAATGAGAGAGGTGAAAATGAGGGGTCATCTGATAGTGTGCCCTCATCACCACTTAGAAAAGTCTCATACGAGACTCAAACCAGCACGCCGTCGAGACCTTCAAGAACAAGCAGTAACATGTCAAATTTTGTGTGGAGCTCCACGTCGCGATACAGACCGTTTGTTGACCACAGCATCAAAAAAATGGGGTTGATAAAACTTGGAAAGAGACTGGGTGACATTCTGGAGACCAGTATGATGAAAGCTCGGAAAGCATTGGTTCTTCCAGGCAATAGTGATGGCGATGAGTGTCAGTGTTGTGATCCTGTTGCAGTCGAGCAAAGACAGTGGACCATAAACAATTTAGAGGCTCTTTTGAATGGAGAAGTCCATGAATGTTTACGTTTGAGGTTACAGCATCGACCCAAAGGGGAGCCTTCATCTTTGAGTGTGAGACAGCTGTTACGAGAGTGTAAGGATGTGCTGTTGGGCGGAGTTCTTGTCAAAGACTATTACCTTGATCTTGTGGATGGCATTGCAATCTCAGAAGATTTCAGCAAGGAAAACACAGAAAGTGACATTGAAGGTTTTGAGCAGGATCTCCAGAGTTTGCTTCAGGTTTATTTTGAATACTTGCACAATGTGATCCTCTTGGTTCAGAGGCTTCCTCAGGCATCAAAAGGACAAAAGAACATTCTTGAGGAAGAGTGGAGCTTTGTGAAGAAACACTGTCGTCAGGTCAGAGGAGGAGAAGTTGAAGGGGGAACTAGATTTTGTGTCATGGCTTCAGGCTTGCTTGAATCGACTGGTGATTTTCTGGAGTCAGAATTGGATCAGAGTTGTTCTGATCTTCATAACAATACTGATCACAGTGACGATCTCAGGCGAAAAGTGTTAGAAGCTTGCCGAGGTTTTAAACACCTGTTTAACGAGGCAAGAGAAAGGGCTTCTAAAGCCCTTGGTTTCACCAAGAAACTTCAGAATGACCTTGAAAATGCCGCAAAGTTCAACATTGATGTACCTGTGTATGAACTGTTGACAAGATTGGAGGCTAGTGGACATGTACAGGTTGTAGCAAGACACACTGCTGGTCTGCTTATGTTTGTGCCAAGAACAATGGTTAAGAAAAAATGTCAAATCATCCACCTCTTGAATTCCTGCTGTGTTCAAGAAGAATTTGGTGACCAAGTTGTATGTGATCGTTCGGCATACCTTCTAATCATGCCGTCATGTGATGCAGAAAGCGGCAATGAGACACCTGTGACGTGGAATGGCAAGAAGGTGGTCGTCAATCCGACAATGGACACTGCCATCAGTTTAGCAGACATACAGGTAGGGGGTGTGATATTGGTGGTACAGAATTCCAAGGAGTTGGATGTTCAACGTAAAGTGTTTCTGGAGAGTATGAGTTTATCTGTCAGCGTTGTGAAGCCAAGGACGTCAAGTCATCAGGCCATCGCTGAAGCACTGGATGAGTTGCAGGAAGCATGTCTCACTCTTCGTGAAGGAATTGTGAGTGCCGTTAAAAGAGTTGACGAGAACTTGGATCTTGATAGCATGTTTGAAATGGAGGAGACAGAGAAAGCCATGGTTTATCAAACCTACACGGAAACGATGCATCTGTGTTATAATGTTGGTTTTGAGTATCAGAAAGAGGTAGCGCGATTGGTAGTTGGTGATAGAAAGGATGCTCTTGGACACGAAATGCTAACATTTGCCAAACAATGGATGAAGTTTGTGATGACGAAATGCGAGAGGGGGAGAGGCACAAGACCAAGATGGGCCAATCAAGGACTTGACTTCCTTACAGTGGCATGTGACCCTAAGACGCTGACAACATTGTCAGAGTCTGCATTCCAGGAGTTGAAGAAAGAGATCAACACATGCATCTGTCATGTTATCGGCAGCGCCGAGAGTTGTAGTGGAACAGCCAGCCCAGCATACAGATCTCAAAGCCCAGCTTGTCCTTCACCAGTATTCGGTAGAAGTGCTGCCCCTGTAGGACTACTTAGGCCACTTTCTTGGCCAGCGGGAAAGCCACCCAAATCTCCAGGAGACCCGGCTGACACTGATGAAGGTCTGGCCACACGGCGACAGCTGTCAGATCCTATCTCTAAACAACAGTTTCAGAGTCTAGCAACAGATGTCAACAATAGTGTAAATGATGCTGAGGGTGAAAGTGGCGATGAAGGAGAAAAGGAAAGCAAAAAACACCGAGACAGCTTTGTAGCAACACCGGATGCTCCACGGTTAGAGAAAGTCCGCCACTCATTGAAGAAAGTGGAAGCAAAGAGAAACGAGTATTTATATGACAAGCATGTTATTGGTCGTGTGAGCAACAGACGGCGTGACATTGTCAAGGAGCTAGCAAGCATTTCCAGCAGGAAAGTGCCATTCAAGTGGCAACGAGGAAATAAGATTGGTGAAGGTCAATTTGGAAAAGTGTATGCTTGCGTTAATTTGGATACAGGGGAGCTGATGGCTGTCAAACAGATCAAGTTTCAGCCTAATGATCATGGTGAAATAAGGGATCTCGCTGATGAGATTAAGAACTTTGAAGGGATCAGACATGAAAGCTTGGTGAAGTATTATGGTGTTGAACTACACAGGGATGAGATGTTCATCTTCATGGAATACTGTGCTGACGGCACCATATCAGATGTGGCCAAGCTTGGTCTTCCAGAATCCATGATCAGAAGGTACACTTATCAGATACTTGTCGCTGTCAACGTGCTTCATGAAAAGGGGATTGTTCACAGAGATGTCAAAGGTGCCAACATATTTGTTTCATCTGGTGGTCTGCTCAAGTTGGGTGATTTTGGATCGTCCATCAAACTAAAGAATCCACTTCAGACAGTTTATGGAGAGATAAGCAACATACGCGGGACAGTAGCTTACATGGCCCCAGAGGTGATCACACTGGACAAAGGAGCAGGTTATGGCAGAGCAGCGGATATATGGAGCATTGCATGTGTTGTGGTTGAGATGGCAACTGGAAAGTCTCCTTGGCCTGATTTTGACAACAACTTTGTTATCATGTACAAAGTGGGCGAAGGAGCGACCCCTGCCATCCCTGAAACTCTGAGTGAAGAGGGACAGGATTTTCTACTGTGTTGTTTCTTGCATGATCCTTATGCAAGACACACCGCTAATCAGCTGATGGACCACTCTTTTGTCAAGGTAGATTTGTGA

Transcript

OS493_009855-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y6R4	Mitogen-activated protein kinase kinase kinase 4 OS=Homo sapiens OX=9606 GN=MAP3K4 PE=1 SV=2
O08648	Mitogen-activated protein kinase kinase kinase 4 OS=Mus musculus OX=10090 GN=Map3k4 PE=1 SV=2
O14299	MAP kinase kinase kinase wis4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=wis4 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004248 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19431 all species →	MEKK4_N	MEKK4 N-terminal	Family	Interproscan
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR050538 all species →	Family	Mitogen-activated protein kinase kinase kinase	Interproscan
IPR045801 all species →	Domain	Mitogen-activated protein kinase kinase kinase, N-terminal	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48016 all species →	MAP KINASE KINASE KINASE SSK2-RELATED-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0000165 all species →	Biological Process	MAPK cascade	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04428	MAP3K4, MEKK4; mitogen-activated protein kinase kinase kinase 4	EC:2.7.11.25	Protein kinases	ko01001	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_009855-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

21.9Max TPM

11.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.66	21.88
polyp at pH7 6	18	18	14.27	20.23
coral polyp · control treatment	16	16	12.60	19.76
coral polyp · oil and dispersant treatment	16	16	8.79	15.79
coral polyp · oil treatment	16	16	12.00	19.36
coral polyp · dispersant treatment	16	16	8.92	14.86
Polyp	10	10	4.69	8.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.88
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.40
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.42
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.01
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.54
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.41
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.89
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.58
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.95
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.21
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.62
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.61
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.00
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.38
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.21
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.87
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.09
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.05
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.88
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.52
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.14
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.29
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.65
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.57
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.67
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.62
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.51
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.84
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.76
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.88
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.83
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.45
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.40
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.14
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.47
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.11
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.06
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.89
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.84
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.57
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.52
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.79
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.23
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.43
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.39
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.65
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.92
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.69
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.30
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.23
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.22
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.74
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.62
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.40
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.92
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.76
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.54
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.88
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.66
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.80
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.08
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.98
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.86
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.91
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.75
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.26
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.78
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.25
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.90
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.05
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.77
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.47
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.96
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.81
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.72
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.05
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.34
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.88
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.65
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.74
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.06
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.92
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.73

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.