Gene detail

Detailed information of OS493_010093-T1 in Lophelia pertusa

Genomic Location: scaffold_24:2746758...2782307
NR annotation: KAJ7337236.1, Leucine-rich repeat-containing protein 16A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010093-T1

ATGGCGGATGATTCCGCGGAGATTGAGCCGGGTCTCCTAGAAAATGTGCAGTTGGCTATCAGAAGGAACATAGAATTGGCCTTTGTCAAGAAAGCGAAAATAGAATTCAAGGGTGACCGTGCCGAGGCTCGAATTTTGGCCCTTTCTGCTCACAGATTCTACGTCCTTACCAGCTCCAAGAATGGCTGCAAGGTGGATTTTAGCATGCATGTTTTGGAAATACAGAAAATCGAGAGTAGTAAACCTCTTTTGTTAACACTTATATGTGGAGACAAATCACATTATTTCCGAGTTCTTCAACCAAAGGACTGTACAGATATTATTGCCCATATCTTGGCGTCTCTTAAATCCAACTTTCCAACTGGCAGCCCAGACCGTCTTCTAAGGGTGGTATACGGGCCGCCAGAAGAAAGCGATGATCGACAAGCACAAGTGACAACACTTGTCAATAACCTACGGAATACAGGAGGAGATGTAGAGATTGGGCCATGTGGTGGATTTTCTAAAGTTTATGTTTCTATGTGTGATTTTTATGGACAGCCACATTGGAAGAAGTTGTTTGGGTATACCAAAAAGGACTTGGTTCCTCTTATTTCAACACTGGAGTACAATGATTGGTTCACTAAAGTGACCTGTGATTCATTTAAACTGGGATCAGAAGTTTGCGATGCAATCATCAAAGTTATCAGAAAGTCCTCTACAATAGAAGAATTAGTCCTTGATAGTGCCAGTTTCGGCAGGGAAAACTGTCAGAAACTTGCATTGGCTCTCACATCAAATCCCAAAACATCTTTGCATAGCTTGAGTTTAAACAGTAACTCCATTGAGGATAGAGGTTTAATGCACATATCTGGTGCCTTCAGTAAGCTTCCCCAAGGTTTGGTGTGTCTTTCTCTTGCTGACAATGGAATCACATCTAAAGGAGCAAGCTCACTGGGTCAGGCATTAAAAACAAATAAGTATAATGAAAGCTCACTGCATAGACTGGATCTTAGCAGAAATCCCTTGAAAGGAGATGGAGTCGCTGGTCTGTGTGATTTCTTGGCCAAGCCAAACATGCTGACTCACCTGGATCTCTCGGCAACAGAATGTCCTCTTGACTTGTTGTTTGGTGCTCTTATTCGAGGCTGTGCTCAACAGTTAGCATCTATCAACCTTGCTGGAAACAGTTTTACCTCAAAGAAAACTAAAGATGCAATTGTTCCGCCATCATTCAAACAGTTTTTTAGCAGTTCCCAAGCTCTTAAATTTTTAGATGTATCAGATTGTAAATTACACGCTGATGCTGTGAGAGCGATCCTCGAAGGATTACGTGAAAACAGTGTACTTTGTGAAGTTGAGCTGAATATCAGCAACAATGAGCTCAGGGGTCCTGGAGCCAAAGCAATTGCTGAAAATATAGCCAACCTGAAATGTGTGAGCAGACTGGATATCAGTGATAACAGTTTTGAAATGGATTTGATCAGGATTCTTGAAAAACTGTATAAAAACAAAACATTGAAATATTTGAACTTGGGACAGAACACGAGACAGCGGAGCTCATCTGCAGTTATGGAAGCATTAGTGCAGCTTATATCCGAGGAAAACTCACACATTGAGTCCATCTCTTTGACTGAGTCCAAACTGAAACATGACATCATTCCACTCCTGGACGCTCTTGGAACAAACGAAACTTTGAAAGAACTTGACATCAGTGGAAATCAAATGGGTGACGAAGGAGCTCGCATTCTGGGCAAGGCCCTCCAAATCAACACCAAACTTAGGACGCTAAACTGGGACAAGAATGGGACGACGTACAGAGGATTTGCTGACATCGCAGCAGCCCTGGAGTGCAACCACACACTACTCTCCATGCCAATGCCGCTACACGATGCTGCCCAGTCACTCAAACCACAGACAGAGCAACACTTAAGAAAGATCGAGAAGTTGTTACTCAGGAACCAGTCGCCTCACAAAGTGGTGACAGAACAGGCGTACAGATTACAGCAGGGTCTCTTACTCACCTCCACACAGCAACAGATGGTGGACCGCCTCGTGGTTCAGTTACAGGACCTCGTGAGTGAGCTCCGACCCTCCAAAGACCCTGACGTGAAGAGCGAGATCAAAACTGCCAAACATTTTGTACAGGATGCAGACAAGCTCAAACAGTTGCTGCTGAAGTTCCATTTGTGTACAAATGACAGTGACATCGAGGCCAGGTTTGCTGAGCTTTCTGGTGACTTTTATAAAGCAGCTGAAGATAAAATGAAGAACAACATGGACAAGATGATCGATTGCGCAAAAGAAGTTTGCCCTTACATTACGTCTTCAGACGATGTGAAGAGCCGTCTACAAGCTGTTGTACAGGGCAAGTCAAGTCTGAGTGAAACGTTTGTGGACGAAGTCATACTCACTCGAGCTGCTGCGGGCATCGCTAATAGGCTAAGTGAAGACAAGCTTACAGTAGCCTCCATCATGGCAGACACGATCATGGAGATGGTAATACATCAACTGGAGAAAAGTGTCAACAAAATGGAGTTGCTTCTGAAGGACCATCGGAACAAAATGGACGACAAGGACGGGGAGACTGAGAAGAGCGCGGAAGAAGACGACGTGGCAGCGGTTGCTCGTCAAGCTCGTAACCGCCTCAGCTCAGCCCAGTTGACGGTGCCCGTGACAGAAGGGATAGAACCTGGTGGAAGGAGCAACAAGAGGAGGCCTACAGTCAACAGACGTCCGTCACCCAGCAGGGTCCCTGAAGAAGACGAAAAAGACAACAAGGAAGAGGTCAAAGTCGCCAAGGAAGAGGTCGTGGAGATGCCTCCACCTCAACTGGTAGTCGCCCCACCTAATGCTGACTTCACAGACATGGAGACAAAGGCCTCGGATCTGAAGCACTTGGTTAAGGATCGGGCTCGGCCCCCTCAGAAAAGGCGCCTACCCACCCGTCCCTCCAACAGACCAGGAGTGGCTAATGGCTCTGCCCAGGACGAGGGCGGCGAAGAGGAAGATATTGAAGTATTTTGGAGCAAGGCAGAGAGCAAGCCGGTGGAAGAGCCAAGTGTGGTAGTGACGCCCGATAAAAGCACAAAGAAGACATCAGTGACTAAATCACCACCCTCGACTGCCACTACATCAAGCAAGACCCCTCCTCCCAGACCTGCACCCAAACCAAAACCTTCACCCAAGGCAAAAGACGGCGAGGAGAATAAAAAATCTGGTTGGATCCCCAAAGGGGGTATCAGTCTTCCTGGATTTTTTAAGAAGAAAGGAAGCAGGGATCGTGCTGCAACGGCGCCTGGTACAACAGACACGGCTTCCACAGCGTGGTATACGAATAACGAAGCTGAAAAGAAGAAAAACGCAGAATCCCGAAATGGGGCTCCTTCAAAGGAAGAGCCTAAGGCTCCTAAAGAGAGGGTCCCCTCTGAGAAGAAACCAGAGGTGTCCAAGGAAAAGGTCCCCTCTGAGAAGAAACCAGAGGTGTCTAAGGAAAGGGTCCCCTCTGAGAAGAAACCGGAGGTGTCTAAGGAAAGAGTACCCTCTGAGAAAAAACCAACAGTGACCATAGAAAAGGCGGCCTCTGGGAAGGAACCGCCCTGTGACAAGAAACAAGAAGTACCCAAACAACGGACACCCTCTGAGAAGACACCTGAAGTGACCATAGAAAGGAGAGAAAGGGCTCCGTCGGGTGGTAAACCGGAAGTCACCAGACCACCCATAATGGGAGTGAAGCCATTTGGTCTTCCACGTGACAGGGTCTCTACAGAGACCGCCTCCCGTGTACCATCTGCCCAACCACGTGATAGGGCGTCCACAGGTGACAAGAGTCTTACAAAGCCCGCCCCTGAGGAGCCTGCCAAACCTCGCGGACCGCCCAAATTTGGAATTGGGATAGGCGGGGCTGCAGGGGGAGGGCTTTTGGCTGAAATGAAATTGAGGCAAGAGAGAGCGGCTAGTTTAGGAAGGAACAAACCCGCTGACAAGCCAGCTGAGAGCAAACCAGCTGCGCCAGGACCGAAGGTGACCATGGGAAGTACAGAGACTGATGCGGAAGTCGCCAAGGAAGGGCTCGTGAAACCGTCGTCATTCAAGAGGCCCAGGCTACCGTCCGGTACTCCGCCAAAACCGGCTCCACGGCCTGGTAAGAAAGACAGCAAGAAAGAGCCACAAGAAGAAAAGAAAGAAGAGAAAAAGGAGGAAAAAGCAGAAGTGAAGAAAGAGGTGAAACCAGAAGAGAAGAAAGAGTTGAAACCGGAAGAGAAGAAACAGGAAAAACCGGAAGTGAAGAAAGAGGTTAAACCGGAAGAGAAGAAAGAGGAAAAACCTGAAGTGAAGAAAGAGGTTAAACCGGAAGAGAAGAAAGAGGATAAACCGGAAGTGAAGTCAGAAGAGAAGAAAGAGGAAACACCGGAAGTGAAGAAAGAGGAAATATCTGAGAAGAAAGGTGAAAAACTGGAAATGAAGAAAGAGGACGAAGCGGACGGGAAAAAAGAAGATCCCGAAGAGGAAAAAGCAAAAAAAGTGGAAGAGAAAGAGAAAACGGTGGAAGATACAGAAAAGGGCACAGAGAATGTTCCAGTTGAAGAAGTAAATAAAAAGGAAGAAGAAAGGAAGGAGGAGGATACGCAAATGAATGTAGGAGTTGATGAGAAAGAAGAAAAGCCAAGTGAAGAAATAGAGGAACCGAAAGAAAAAGCGAAAGAGAAATTAGAAGATGTTATCCCTGACACTGGAGTAAGCAAAGGCGAAGAAACCACAGAGGGAAAAATAGTGTGGATGGAAAGGTAG

Transcript

OS493_010093-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5VZK9	F-actin-uncapping protein LRRC16A OS=Homo sapiens OX=9606 GN=CARMIL1 PE=1 SV=1
Q6EDY6	F-actin-uncapping protein LRRC16A OS=Mus musculus OX=10090 GN=Carmil1 PE=1 SV=2
Q8ND23	Capping protein, Arp2/3 and myosin-I linker protein 3 OS=Homo sapiens OX=9606 GN=CARMIL3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003741 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16000 all species →	CARMIL_C	CARMIL C-terminus	Family	Interproscan
PF17888 all species →	Carm_PH	Carmil pleckstrin homology domain	Domain	Interproscan
PF13516 all species →	LRR_6	Leucine Rich repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR031943 all species →	Domain	CARMIL, C-terminal domain	Interproscan
IPR041245 all species →	Domain	CARMIL, pleckstrin homology domain	Interproscan
IPR051279 all species →	Family	Protein Phosphatase 1 Regulatory and Actin Interaction Protein	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24112 all species →	LEUCINE-RICH REPEAT, ISOFORM F-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0016477 all species →	Biological Process	cell migration	Interproscan
GO:0030027 all species →	Cellular Component	lamellipodium	Interproscan
GO:0034315 all species →	Biological Process	regulation of Arp2/3 complex-mediated actin nucleation	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20493	LRRC16, CARMIL; leucine-rich repeat-containing protein 16	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010093-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

72.7Max TPM

32.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	34.03	55.95
polyp at pH7 6	18	18	30.48	43.82
coral polyp · control treatment	16	16	43.61	72.72
coral polyp · oil and dispersant treatment	16	16	30.90	42.87
coral polyp · oil treatment	16	16	34.90	52.78
coral polyp · dispersant treatment	16	16	32.72	48.18
Polyp	10	10	16.44	29.59

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.95
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.18
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.99
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.33
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.27
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.99
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.18
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.39
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.07
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.46
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.84
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.30
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.23
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.34
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.98
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.39
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.30
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.05
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.49
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.14
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.07
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.68
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.52
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.50
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.41
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.83
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.28
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.33
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.09
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.72
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.97
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.37
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.89
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.06
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.95
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.48
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.66
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.74
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.67
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.14
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.99
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.87
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.47
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.20
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.83
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.79
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.34
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.67
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.39
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.30
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.50
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.15
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.21
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.78
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.24
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.50
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.09
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.91
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.30
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.24
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.60
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.73
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.16
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.58
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.26
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.44
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.18
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.00
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.22
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.47
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.97
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.39
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.69
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.11
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.78
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.71
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	29.59
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	25.20
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	19.75
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.84
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.10
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.73
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.63
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.38

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.