Gene detail

Detailed information of OS493_010103-T1 in Lophelia pertusa

Genomic Location: scaffold_24:2848752...2870322
NR annotation: KAJ7337246.1, hypothetical protein OS493_010103 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010103-T1

ATGAGTGTGAGAGAGAGCTTTCTGAGGCCCAAAGCAGATGTACGCTTGGATTTTCCTGGTGATCAAGTGGACAAAGACGAAGATGATAATGAGGGAACATCTGGATCAGGCAAGGTGACAGTTCTCCTAGTCGACTACCGCAACAGTAAATCACGACTCGCTAATGGTAATTGCTGCGACAACTTCTTCTCGTGCATTAATGATTGCGACAACTTCTTCCGGTTGTGTTTCGCCCAGACCTCTTCCTCTGACAAGTGCGCGCTGTGGAAAGGCTGGACACCAGTTCTTGGTGACGACAGTTTTTCCTTTCCACGTGCCGGAGGGAGTCTTGGAAATGGAATCACCAACCCTGTAACTTACAGCTTTACACGTTGGCAGCCAATTGTGTTTGACGTTGAGGTGTGGGACAACGATAATGGTAACATCATCGGACCTGCCAATGACTTTGTGGATCGTTACTCGTTGTCCATTCAAACCACCCCTTCTCCGTATCACCTTGCCTCTGCAACCGCCAAACGTCACAAATTGACGGGGAATGGATACTCTTACTTAAACGTCGAGGTCAAAGTGTTTTGCGACGCAAATTATTTCATACCGAATTGTACCACATACTGCGTGCCACGAAATGACAACACTGGGCATTACACTTGTGACACTCGTGGTCAGAAAGTGTGTCTTTCTGGATGGTTCGGCAGTGACTGTCTAACTTACTGCCTGGCCAAGAATGACACCTTGGGACATTACAGTTGTGATGGAAATGGGCAAAGACACTGTCTGGATAACTGGTATGGCCAAGACTGCTTGGTTTATTGCATACCCAGGAATGACTCTTTGGGACATTACAGTTGTGATGGAAATGGGCAAAGACACTGTCTGGATAACTGGTATGGCCAAGACTGCTTGGTTTATTGCATACCCAGGAATGACTCTTTGGGACATTACAGTTGTGATGTAAATGGGAAAAGACACTGTCTGGATAACTGGTATGGCCAAGACTGCTTGGTTTATTGCATGCCCAGGAGTGACTCTTTGGGACATTACAGATGTGATGGAAATGGGCAAAGACAGTGTCTGGATACCTGGTATGGCCCGGACTGCCTGGTTTATTGCATGCCCAGGAATGACACTTTGGAACATTACAGTTGTGATGGAAATGGACAAAGACTGTGCCTGGATAACTGGTATGGCCCTGGCTGCTTGGTTTATTGCATGCTCAGGAATGACACCTTGGGACATTACAGTTGTGATGGAAATGGACAAAGACAGTGTCTGGATACCTGGTATGGCCCGGACTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGACATTACAGTTGTGATGGAAATGGACAACGACAGTGCCTGGATAACTGGTATGGCCCTGGCTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGACATTACAGTTGTGATGGAAATGGACAAAGACTGTGCCTGGATAACTGGTATGGCCCTGGCTGCTTGGTTTATTGCATGCTCAGGAATGACACCTTGGGACATTACAGTTGTGATGGAAATGGACAAAGACAGTGTCTGGATACCTGGTATGGCCCGGACTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGACATTACAGTTGTGATGGAAATGGACAACGACAGTGCCTGGATAACTGGTATGGCCCTGGCTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGACATTACAGTTGTGATGGAAATGGACAAAGACTGTGCCTGGATAACTGGTATGGCCCTGGCTGCTTGGTTTATTGCATGCTCAGGAATGACACCTTGGGACATTACAGTTGTGATGGAAATGGACAAAGACAGTGTCTGGATACCTGGTATGGCCCGGACTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGACATTACAGTTGTGATGGAAATGGACAACGACAGTGTCTGGATAACTGGTATGGCCCTGGCTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGACATTACAGTTGTGATGGAAATGGACAAAGACAGTGCCTGGATAACTGGTATGGCCCTGACTGCTTGGTTTATTGCATGCCCAGGAATGACACTTTGGGGCATTACAGTTGTGATGGAAATGGACAAAGACAGTGTCTGGATAACTGGTATGGCCCAAACTGCTTGGTTTATTGCATGGCCAGGAATGACACTCAAGGACATTATACGTGCAACAGTAGTGGACATATTGATTGCTTGTCAGGGTGGAGAGGGGATAATTGCACCGAAGAGAATGTTACTAGTTCAGGCACGGCTGTCTCCTTTGCAGTAACTTCTTACACGCTCTTAGTATCTACAGCACAACGAGCCACAGTCCCCTTGACTACTTCGTCAGTTTACTCCTTGATTCCTTCGTCAGTTTACTCATCATCACTGCATTCCTCAGCTTACGACGTAGCAAAGACCAACACACTACGATCCTACGGCTCCTCTGCAAATAAGGGTGGTAACAGAAATTTCACTTCGAGAATGTCTGGCCATGGCGTGACACAAACTAAACTGCCGTGTTTTAGCGCGCTCATAACCACAGGTACACTCCAGAACATCAACACGGAGAGCGCCTCTTTTCTTGTAGCAGCTCATACAACTGCAAGCGATGTTTCCAAATCTTCCTCAGTATCTAGTTGTTCTCTGGATAAGCTCCCATCATTGCTTACAACTTCTAGTGAATCTAGAAAGGTGCAAAGAACTGAGGCTACGAAGGTGACGATCCCGCCTTCATTGCTTTACAGTACATCTGTGATTTCAGAATCGAGCACTTACAGTCCACAGACAGGTGCACGCACTTTGATATCAACACCTTCTGTTGTACCTCTTTGTACTTCAGATAAAGACGTCATAGACCAACAAACGGAAACGGCTAGGACGCAACTTCATAGCACTTTAGGTCTTCAACATCAGACGTCATTGTCTCAGCTGAATTCACCATTGAGCGCGTCCAGTCCACAGAAGGTCGCGCCCACTTTGATGCCAACGCCTTCCATTGGATCACTTTGTACTACAAATGAAGAGGTTACAACACAACCAACTCTAACGTTTGATAGTACTTTAGGACTTCAACAGCAGACGTCTTCATCTCAAGAATTTTCAAACCCGAGCTTTTCCAGTTCACTGACGTCAGTTGCGCCCACTTTCACCTCAACGCCATCCGTTGGGTCGCGTTGTAATACAAATGAAGAAGGTACAGCGCCACCAACATTTCAACCTGACGAAACGTCCGCCATTCCTGGAATCATAGTAGAGTTTCAGCCGATCAAGAAAGATAAAGAATTGATGGTGCCTTTAATGATAAGAACAATCAAGACTATCTTGGCTGAGCAACTGAACACAATCTGCAGAAAAAACACTGAAGCATGTAATTTATCCGAAGAAGAAATAACCAGTGCGTGGTATTGTCCGCGGGTTGTAACTGTTGAAATTGATGACGTCACGGGGAAAGGCGTGTCTTTCAAGATAACATCCGCGCTACCACCACCGTTGAACGCAATGGTTCCTCCCCAAACTTTGATGGAAGTTTTACAGAAAAACAAGGAAGATATTGAAAGTGCAACGCAAGCAAACATCAGCTGGATACGAGTTTATGGCCTAACGACTCCACGCAGTTATGACAACCCCGACAAGATCACGCGTGCCTCGTCACGACAGAAGACAAGTTCGCTGCCCTATATTTTCGGTATCGCAGGCGTAGGATTGATAATGGTTGTGATACTTCTAGTTGTGCGAGCAAAATATGCCAAGAACAGGATACAACCATGTGTTGATGATGAGACGCCTCCTTCTCCATCTTATGAATGTCAACCTGACACCATTTTCCTTTTGTCCGATATGAAGGAAAAATATGTTTGCAAGGGCAAGGAAAAAGCAGGCCTCCACGAGGACTATGATTTTCAGCCGCCTGGAGCCGTCGAAGAAAATAATTTATGA

Transcript

OS493_010103-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000327 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07657 all species →	MNNL	N terminus of Notch ligand C2-like domain	Domain	Interproscan
PF01414 all species →	DSL	Delta serrate ligand	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011651 all species →	Domain	Notch ligand, N-terminal domain	Interproscan
IPR001774 all species →	Domain	Delta/Serrate/lag-2 (DSL) protein	Interproscan
IPR052108 all species →	Family	Multiple EGF-like domains/Integrin beta-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24035 all species →	MULTIPLE EPIDERMAL GROWTH FACTOR-LIKE DOMAINS PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007219 all species →	Biological Process	Notch signaling pathway	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0007154 all species →	Biological Process	cell communication	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010103-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010103-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

8.8Max TPM

2.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.53	4.95
polyp at pH7 6	18	17	2.69	6.26
coral polyp · control treatment	16	16	2.26	6.89
coral polyp · oil and dispersant treatment	16	16	1.60	3.40
coral polyp · oil treatment	16	16	2.23	5.28
coral polyp · dispersant treatment	16	15	1.48	4.13
Polyp	10	8	1.49	8.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.95
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.17
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.66
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.27
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.63
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.44
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.43
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.37
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.34
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.52
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.49
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.90
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.26
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.79
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.44
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.70
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.51
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.42
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.15
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.39
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.11
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.56
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.82
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.23
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.07
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.80
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.76
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.21
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.13
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.02
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.91
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.56
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.15
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.52
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.97
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.64
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.55
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.36
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.22
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.19
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.94
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.63
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.60
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.30
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.28
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.75
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.40
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.07
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.00
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.87
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.85
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.61
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.39
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.20
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.02
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.30
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.13
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.22
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.94
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.72
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.67
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.37
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.26
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.47
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.91
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.72
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.22
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.