Gene detail

Detailed information of OS493_010259-T1 in Lophelia pertusa

Genomic Location: scaffold_25:430102...444400
NR annotation: KAJ7392608.1, hypothetical protein OS493_010259 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010259-T1

ATGATTGAAGACTTTGCAACGCCAACCTCCTCGCAGGCTTTAAGCAGCATCCCGTTACAGTTCTTGCTGTACGTTTTTGACTCTAATGAAGCGTGCAACGAACGCCCGGAGTTCACGGCACAGACGCGGGCCAAGGGATCCTGCATTGGTATCCCCCCTGGGGGAACATACTTCGATCGTATCATTGTGCGAGCCGGTGGACCATCAAAAAGTATCGTGGAGGTAACCACAAGCAGTCCCCCCGGATTTATCAAATCTCCGGTGGCCCAGTATGCACAGCAGGAATACTACGTTAATGTCACGTGGACACCGACGTCATCACAGATACAGACTAAGCTGTTTTGTTTTACTGGATTGGAGAATTCTGGGATAACAACGGAACAGCGATGCGTTACACTGCTTGTTGGAGTGGCTCCGCCACAAATCGTAAGTCTCTCACCAAGAGGTGAAGTTCTTCCGGACACACGACAATGGACCATAACGTTTGACAAACAGTTCGTGCGTCCTACGCGAAGCAGTTACATCAGGATTCATCGCTCGGACGGCACAATTGTGTTCAGTGTTGATGTAGCTATTACCGCTGCGGTGTTGTATCCAGTTGGGAGCCTGGGGCGAACCATTCAATTCACGACTTCAGTAAGGTTTACGGAGAGAGAGATTTACTATGTAACAATGGATCCAGGTATAGCAAAAGGCGTTACCTACTGTGGAGCTGAGTCGCCTCCAATCAGAGATCCCGACACCTGGAGCGTAAAAATAAAGGATGTCACTCCACCTGCGTTAACGTTTGTGAGCGCTCCTTCCCGCTCCAGCGATGACGTCGAAATCACGTGGACAGCAAACGAAAATGTCACAGCTCAGTGCACAGTGCAAACTCCTTCCCAGATCATTGCTCAGCCATGCAACATGTCGTGGACTGGAACCAATCTAACCGAGGGCTACCACAGCATTTATGTTCAGGTGACGGATTTGGCGGGAAACACAGCACCTCCTGTCAGACACTCTTGGTTTGTCGACCGCACTCCCCCTCAAGTTATAATCACTTCCAAGCCTGCTCTACTAAGCAATCAAAATTCGTTCACCTTTGGCTTTTATTGTCGGCGAGAAACATGTTCATTTGAATGTGTAGCAACTCAGCAAGGTAACAGCCCCGCTTATTCTCAATGTAACGCCAAACGTTACACGGCGAACAATCTGCAAAACGGACAGGTCTACGTGTTTGGAGTACGAGGAACGGACGATGTGGGGAACCAAGGAAATCCAGTGAATTACACATGGAAAGTTGACTTACAGCCTCCAGTTATCTCAAACATGGCTGTAAAGACAGTGGATTGTACATCAGATCTCAGCCCATCAGTTCTGGGTGAACCTTCAGTCAGTGACCGTGAAGGATCGAATATAACATTAACTCATCAAGACATTCCAGGAGGTAGCTGCAGCTTTCAAAGAAAGTGGACAGCAACAGACCAGGCGGGCAATATCGCTACGATTATCCAGGACATCAGTCTTAGCAATCCTAGCCCACCGACCGTGAGTTATCATGGGAATGCAACCATTGCGTGTGGAAGCTTTGAGGAACAGCAGCAAGACATGCGCGATGCGATCAACGTCACTCATCCGTGCGATCGACCAATCACGATAACGCACCTAGATTCCGTTCCCACTATCCTTTGCGCGAGGACCTTCACGAGAACATGGACAATAGCTGATGATTGTGGGAAGCAAGTGTCCGTTCACCAACAAATCAAAATTTTAGCGCTTCAGTTGCCGGACTATCCCAAGAATGGACAAGTTAATGTAGCGCTGGGAGAATCGCTTCGGTGGCCGCAGTATCCAGGATCTGTTTGGTACAATGTCTACTTTTGGCGGTACGGCAATACAAAGCCATCATCAGCAACTGGCTGGACTTATTATCGAAGATACTCCCCCTACTCAGGCTTCCCAGCGGATACCCGGATGTTATGGAGAATTGAATACGTCCTCAGCTCAGGTGCACTGGTACCCAGTCCAGTCTGGGGATTCCAAACCAGGGCTTTCCCGGACTTTAAAGTGGAGAAGATCATGGTACCTCCAAACGCTTTCTCGGGTTTCACGTTTGAAGTGTCGTGGATCGTTCGAAACATTGGCAAGGTGGGGAATGCACTGACCACGTGGTATGATAGCGTGTTTATTGGAAAGAGCACAGTCTTCCGTACTGCAAGGCTTGCAACATATGTGCGTCACAGAGAGATTCTCTTCCAAAATGATGCTTACACTGCTAAGGGAACTGTGCAACTAAAAGTTGACGAGTTCGGTGTGTTTTATGTCTTCGTTGAGACTGACCGGTATAACAGGATAAGTGATATCGATCGTTCTAATGATCTGCTGCTGGGTGATAATCCCGTTCAAGTTTCCCTTACTCCGGCACCCAACCTCAAAGTTGAGAAAATTGTGTTTCCAACTCCATCGTTTTCAGGCAAAACTATCGACATAACGTGGAGGGTGAAGAACTATGGGATGGGTGTGACTGCATACGATTCATGGCACGATAAAGTGTACCTTTCCAAGGACAACAAGCGAGACTGGTCTGACTGGCTCCTGGGCACTTTTTACCATCATGGCATGTTGTCAGTTGGTGCAAGTTATACGCGAAAGAAACCCGTCACGCTACCTCACGCAATCTTCGGTAACTTCTCCATTTTGATAAGAACGGATGTTTATAACGATGTCTATGAGCATAATGACGAGGATGACAATCTCAAGGCGAAGCAATTGAAAATTTCCTTAAGCCCTCCTCCTGATCTCGTGGTAAGTTCAATCACACTGTTGAAGAGTTACTACACAGGAGATACAATCAAAGTTCAATTTCACGTCACAAACGAAGGACTTGGAGAACCGTTTAATTATTGGTGGAGAGATCGCGTGACCATCACTAATATTGCATCGATGAATTATGAAGTTCTCGGAATCACGCATTTCTCAGGCATGTTTCCTCCATCGTCGACATACACAAGGGCTGTGTACCACGTGATTCCTCCTAGCTGGCCATCCGGGACATACAACATCACTGTGTACACGGACTATTATAATGACGTTTTTGAATTCATCTACAATAATAACAATGAGAAAACCGTTCAAATGAATATCACACAAAAGCTGCCTGATCTGACCGTAACGCATGTCAACGCGTCAACGACCGCTGACACTATACAAGCATACGTGAGGGTCTCGTTTACCGTGAAAAATGTTGGAGCGGGAGAGACGACCGAGGAGCCCTGGTTCGACGCAATTTACATCTCGCCGCAAATTAATTTCATTCCGAGGAATGCATTGAAGCTTGGAGATTTCCCTCACAGGGTCAACCTGGGTTCAGGGAAAGCATACAGTTTGGATACGGGGCCGATAAGAGTCAGCAGGGATGTGTTTGGTCAGCGGTACATTCACGTTAGAACCAACCTTTATGGAACAGTCATGGAAAATAACGTAAAGAGCAACATCGGTCCTGCTGGGAATGTGACCGTCCCACAAGTTCTGCCAGATTTGGTCGTGACAAACTTCAACTTGGTGCAGTCTCCCAAGAAGCCCTTGATTTATAGCGATTCTGAAGTATCGTTGAGTTGGACAGTTGAAAATGACGGGACTGGAAATACCATGTCTAAATCCTGGCGCGACACGGTTTATCTGTCAAGTTCTCCAACTGTAGAAAGCAACTCTACCAAACTGACTGACGCAGTCTTCAACAGGCAACCACTAAGCCCTGGGCAGAGGTACAACAAAGATGCATCCGTGAAGTTACCGCCAAGTATTACAGGAACCTACTATCTGGTTTTTGAAAGTCAACGACGGCGGCTCTCTCGTTGA

Transcript

OS493_010259-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001664 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07705 all species →	CARDB	CARDB	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011635 all species →	Domain	CARDB domain	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan

PANTHER

No PANTHER signature was detected for OS493_010259-T1. This gene does have a gene model — the search simply returned no hit.

Gene Ontology

No Gene Ontology signature was detected for OS493_010259-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010259-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010259-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

91TPM > 0

7Conditions

31.9Max TPM

2.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	0.81	1.81
polyp at pH7 6	18	12	0.60	1.46
coral polyp · control treatment	16	14	4.69	31.91
coral polyp · oil and dispersant treatment	16	14	4.42	23.11
coral polyp · oil treatment	16	15	3.84	15.18
coral polyp · dispersant treatment	16	16	3.67	15.00
Polyp	10	4	0.12	0.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.58
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.52
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.50
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.42
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.37
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.95
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.75
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.65
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.54
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.27
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.24
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.13
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.09
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.03
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.98
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.89
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.69
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.29
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.15
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.91
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.27
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.26
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.77
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.97
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.48
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.35
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.30
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.27
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.03
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.11
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.23
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.80
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.13
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.99
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.48
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.27
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.20
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.06
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.06
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.18
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.58
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.18
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.45
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.37
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.68
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.89
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.63
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.44
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.29
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.00
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.31
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.07
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.99
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.12
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.82
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.72
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.26
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.21
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.17
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.16
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.81
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.29
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.04
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.