Gene detail

Detailed information of OS493_010488-T1 in Lophelia pertusa

Genomic Location: scaffold_25:2410615...2428381
NR annotation: KAJ7392828.1, tripeptidyl-peptidase II Tpp2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010488-T1

ATGAATAAACTTGTGAACAAACACAAGGTGATCTTTGTGTCTAGTGCTGGTAACAATGGCCCCGCCCTGTCCACTGTCGGATGTCCAGGGGGCACTGCAGAGTCTCTCATTGGTGTTGGTGCCTATGTGTCGCCAGACATGATGGCCGCTGAATATTCAATGCTAGAAAAACTTCCAGGAAATCAATACACATGGTCCTCAAGAGGTCCCACGACAGATGGCTCATTAGGTGTAAGTATAAGTGCGCCAGGCGGAGCAATAGCCGCTGTACCCAACTGGACACTGAGAGGAACACAGCTGATGAATGGAACATCAATGTCTTCACCTAATGCTTGTGGAGGAATTGCTCTTTTGCTCTCTGGTCTTAAAGCAAACAGCATTCCATACTCTCCTCACAGCATACGAAGAGCACTGGAAAATACTGCACTACATATAGAAGGACTTGATAGACTCACTTTAGGACATGGCCTTCTTCAGGTCGATAAAGCATATGACTTTTGTAGTGAATTTTCAAGTGTCCCAGAAAGAGATGTTAGATTTCAGGTTACCTGTTCAGGGAGTAAGAGAGGAATTTATCTTCGAGAATCTCGTCAGTTGTGTAAACCCTTCAGTGAGAGTATATCTGTGACTACAAACTATGATGAGGATGTTGCTAACGATGAAAAAATAACCCTGAATCTTCGCCTGAGTTTGATCAGTTCTGTATCCTGGGTTACTGTACCGGACCATTTTGTCCTCATGAACACAGTGCGCAGTTTTATTGTGAAGGTTGATCCTCGTGGTTTGTCACATGGAGTACACTTTGCTGAGGTGTCCGCTTATGACATCAGCTGCCCGCAGCGAGGACCTCTTTTCAGAGTCCCTGTTACAGTCATTATACCAAACAGTGTAAGCGACGCGGACCATTACGTGTATGAGATGGAAGAACTGAAGTTCAAGCCCGGACAGGTCCATAGGAGTTTTGTTCACGTCCCAGAAGAAGCAACGTGGGCAGAATTTTCAGTGTCGTCACTTGAAAAGGAGGTCAATGGCCGCTTTCTTCTTCATGCTATACAGTTATCACCTCTCTCGTCATTCAAGGAACACGAGTTCTTTCAATTTTATACTCTCACGCCACTAGGAGAGAAAACTCTGAGTTTTGCAGTGAAGGGCGGCGAGACGTTAGAGTTGTGCACAGCAAGATGGTGGGCAAATTTAGGAGAGTGTGCTATCAAAAGAAGCGTTACATTTCATGGAGTTAGACCCAGCGAGAAAAGCATAACATTGCAAACGTCAAAGGTTTGCCGAGTGGATGTAAAACCTGCTCTGAGGGAAGAGGAACTGTTACCAGCAGTGTCACTCAAAACCCATGCTCAGCCAGTCAGGCCTTCAGAATTCAAGATTAGCGCGCTTGGTTTGAGAGATGTCTTACCAAATGGACGACAAATCTATGCTCTGACTCTCACCTACAACTTCCATCAGTCCAAGGCTGGTGAAGTTAGTCCCAATGCTACGTACTTGTCTGACCTGTTATATGAATCTGAATACGAGTCTCAGCTGTGGATGATTTTTGACTCCAACAAAAGGATGCTGGGAAGCGGAGATGCATTTCCTGACCGGTATTCCGTCAAGTTAGAAAAGGGAGACTACGTTCTTAAGCTTCAGGTTCGACATGATAATAAGGATCAACTTGAGAAACTTAAGGACACAATCGTGTTAATAGAACAGAAGCTTTCTCCTGCCATTACTCTAGACACACATTCCTCGCGTCTGGCTTCCATGAAATCAGGCGGCAAATTCAGTTCATGCACACGAGGGCCTGGTGCCCGGTGTCCAGTCTACATAATGCCTGTGGCGGATGACAAGATTCCCAAGGCTGCCAAACCTGGTCATATTCTTAAGGGGACAATTTCATACGTGAAAAGTGAGACTGGGAAAAAGCGGTTGCAGTTGTTTCAGGAAGACATTAATATTATGAGTGGACTCCAGTTTATTGTACCTGCAACAGCCAATAAACAAAACAACAAAGCTGCCACGACCAAACCCGAGGAAAAACAGTTCCAAGAACTTACTATTGTCAACTCTTTGTGCAATTTTCAGCCCAAGCAACAGTTTGAAGAGGCAATGAGAGACCTAAAAATCTCCTGGATACCAAAACTTGACGATCTCTGTCTCTATGATGAGTTAGCTGAGCAGTATGCTGATCATTTACCGCTGCATGTAGCTCGCCTTCATTTCCTGGATAACTCCAAGGATCGACTCCAAAAGCTTCCACAAATTATAGCTGCAGCGGAAAAAGTCATACAGATGGTAGACCGTGTTGATCTGTCCAGCTACTATGGTATGAAGACTGACCTACGCCCAGAAGCAGCTACAATTAAAAGCGAGAAAGACAACCAAAAAGCTGCATTAGTGGATGCGTTGTGCCGCAAGGGAACTGCTCTGGCTGATCAGATATTAACTAAACCTACAGAAACGACTCTCGGTGAGGAAACGCCAGCAGTTGAACAAGATGTCAGTAGCTCTGAGGATAAAGTAGAGACAGAGGAAGTAATTTACGATAAAATAAATGAAACTTTTAACGAGCTTGTCAAGTGGGTGGACATGACAGATTCAAAGGTTTTGCCGTTTTACATTCGTCGCGCGGAGGCACTGAAACTCTACGGCTTGGCTCTCAAGGCTTCTATGAAACAAAATGGAGATGCAACGCGAAACAGGGCAAACGATGACAAGAATATCGAGCTGTTTGAGAAGCTTGGCTGGGAACATTGTGCACGATCCAGTAGAGAAAGCCTTCTGGTCAAATATCCTGCCAAATACCGGCCGTTTTGA

Transcript

OS493_010488-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P29144	Tripeptidyl-peptidase 2 OS=Homo sapiens OX=9606 GN=TPP2 PE=1 SV=4
A5PK39	Tripeptidyl-peptidase 2 OS=Bos taurus OX=9913 GN=TPP2 PE=2 SV=1
Q64514	Tripeptidyl-peptidase 2 OS=Mus musculus OX=10090 GN=Tpp2 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002921 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21316 all species →	TPPII_GBD	TPPII, galactose-binding domain-like	Domain	Interproscan
PF00082 all species →	Peptidase_S8	Subtilase family	Domain	Interproscan
PF21223 all species →	TPPII_Ig-like-1	Tripeptidyl-peptidase II, first Ig-like domain	Domain	Interproscan
PF12580 all species →	TPPII	Tripeptidyl peptidase II	Family	Interproscan
PF12583 all species →	TPPII_C	Tripeptidyl peptidase II, C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR023828 all species →	Active_site	Peptidase S8, subtilisin, Ser-active site	Interproscan
IPR036852 all species →	Homologous_superfamily	Peptidase S8/S53 domain superfamily	Interproscan
IPR046939 all species →	Homologous_superfamily	Tripeptidyl-peptidase 2, C-terminal domain superfamily	Interproscan
IPR050131 all species →	Family	Subtilisin-like serine protease	Interproscan
IPR048384 all species →	Domain	Tripeptidyl-peptidase II, galactose-binding domain-like	Interproscan
IPR046940 all species →	Homologous_superfamily	Tripeptidyl peptidase II, Ig-like domain superfamily	Interproscan
IPR000209 all species →	Domain	Peptidase S8/S53 domain	Interproscan
IPR048383 all species →	Domain	Tripeptidyl-peptidase II, first Ig-like domain	Interproscan
IPR022229 all species →	Domain	Tripeptidyl peptidase II, second Ig-like domain	Interproscan
IPR022232 all species →	Domain	Tripeptidyl peptidase II, C-terminal domain, arthropoda	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43806 all species →	PEPTIDASE S8	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004252 all species →	Molecular Function	serine-type endopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0008240 all species →	Molecular Function	tripeptidyl-peptidase activity	Interproscan
GO:0008236 all species →	Molecular Function	serine-type peptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01280	TPP2; tripeptidyl-peptidase II	EC:3.4.14.10	Chaperones and folding catalysts	ko03110	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010488-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

26.4Max TPM

11.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.90	25.54
polyp at pH7 6	18	18	8.48	11.26
coral polyp · control treatment	16	16	13.34	21.18
coral polyp · oil and dispersant treatment	16	16	17.10	26.40
coral polyp · oil treatment	16	16	11.60	17.11
coral polyp · dispersant treatment	16	16	8.14	14.27
Polyp	10	10	11.11	17.75

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.59
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.42
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.82
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.03
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.51
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.36
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.41
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.83
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.43
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.78
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.70
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.58
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.07
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.26
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.24
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.72
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.64
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.81
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.55
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.52
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.11
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.56
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.32
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.80
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.13
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.03
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.02
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.15
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.18
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.51
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.07
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.38
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.13
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.99
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.73
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.80
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.40
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.30
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.32
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.15
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.61
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.38
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.40
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.74
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.72
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.22
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.96
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.54
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.46
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.72
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.19
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.56
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.51
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.91
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.11
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.70
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.87
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.91
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.98
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.85
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.51
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.43
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.17
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.61
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.56
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.58
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.11
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.92
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.27
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.70
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.31
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.21
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.11
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.92
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.91
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.56
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.56
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	17.75
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.79
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.34
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.18
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.62
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.45
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.12

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.