Gene detail

Detailed information of OS493_010516-T1 in Lophelia pertusa

Genomic Location: scaffold_25:2634407...2644845
NR annotation: KAJ7392856.1, hypothetical protein OS493_010516 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010516-T1

ATGAGTATGAAAGTTCCTACCATAGTACAGGAAGCCCAACAAGCATCACAGGACGGCTACTGTGTGGTCATTGGTCTGCAGTCCACTGGAGAGGCGAGTTTGGAAAGTGAAATAACACGGTGCGGAGGAGTGTTGAATGGCTTTATTTCCAGCACGGAAGAAATCCTCACCAGGTTTATCACGCAATATTTTCCAACTCAGACAATAAAATCGAATGGCGATGTAGTGGAAGATCAGTGGAGCGTCCAAGCGAAAAATCTTCTGCTTACGTTTGTTAAGAAAGTTAATCTCCCAGTTAGCCCTCTAGATGACCTTATAAACCAGCTAGGGGGACCAGGAAAAGTAGCCGAAATGACGGGTAGGCGTGGTCGTGTGGTAAAAACAGAAAAGCAGCCTCAACCTCATTACGAGGCTCGAGAATCAGACAGCAGCAATGTGGATAGTTTGAATATACAAGAGCGAAACAGCTTCATGAATGGAGCAAAACATGTGGCTATAATCTCAGATGCGGCTAGTACTGGAATCTCATTACATGCCGACCTCCGGGCAGCCAATCAGTGTCGTCGTGTTCACGTGACCATCGAGCTGCCGTGGAGTGCTGACAAAGCTGTACAGCAGCTGGGAAGATCACATCGATCAAACCAAACAAGTGGACCAATCTATAAACTTGTAACTACAAACTTGGGTGGCGAGAGAAGATTCGCAGCGGCTGTGGCTCGCAGGCTCCAGTCACTAGGTGCTCTTACAAAGGGAGACAGACGAGCTGCGACTGGGGCCGACTTAACTCAGTTCAATTTTGACACAACTTATGGCCGGTCTGCTCTCAGGAATATGTACCAATCCATAACTTTGCAAACCATTTGTCCAGGAGTCCCTTTGTCCAAGGTTCTGTCGGCTGCTCAGATTCCTGATAAATATGAATTTATAGAGTTTAACTCGATGGCCAGGCAATGTCTCATATCCATGGGTGTGACAGACGCCAGTTTTGTGGTGAAGGACAAAGAGGCCAGCGATGTCGGAAGATTTTTAAACCGCATTTTGGGGCTTAGCGTAGAGAGACAAAATTTGTTATTCTCGTATTTCTGTGAGTGCCTTCATGCTACGATTGAAAATGCAAAACGTGAAGGAAGGTACAGTGAAGGCGTGACAGACATATCCGGGTCTTCAATCACGATGGTCGGCGGTCCTCAACCGGTTTTCACCGACTTCCAGGGAAGTCTCATGGGAACAAAACACGTGACTCTTAACGTTGACCGCGGAATAGACTGGGACTCGGCCGTCAAGCTGTTTCAAGAGAATGGGTCTAATAAGCTGGATGGATTTTATTGCTCCAAAAGGGAACAGAAAGGAAAACGACTGTATCTGTTGGCGATACAGAAGAAGTCCTCGACACGTCTTTTCAACATTACAAGACCAAACACAGGTCGATCGCCATTTGAAGAAGAAAAGGCTGATTTGCTTCACAAGTACAACAAGATTTCACTTCAAGATGCAGAGGCAGGATGGAATGCGCAGTATGAAAGAACGACAGATCGCTGTATTCATGGTTTAGGATGCAAGACTGGACCTTCCTGTAAAACTGGGTGTCGCATCACTGAAATCCATTTATTGTGTGGTGGAATTATTCCACTGTTATCTGCTTTGGAATTGGCCATGGCAAAGCACGCAGATAAACTTGGACTTACTAAGGAGAGTCGCTCTCTAAGAGTAGTCCGCGTTGAGCTGGATAATGGTCAGCGGCTGGTTGGTTTGCGTTACCCAGAGCAACTCATACCGGAAGTTACATTTTTTCTAAAGGAACAAAAACTTATCGACGCCGTCTTAGAAAAACAAAATGGCGTCTTGGGTATAGCTGGGCCTTCAAAGGAGACATCGAAAGCCAGCCAAGGGTACGAAGAAACCGAAACCTCGATCAACCCAAGAACTTTAACGAAGGCTACAACTCCTCTTGTTACTATTAAAAATTTCTTCAAACCAAAGTCTGTTGAAGAAACAACTGAAGGCAATGCCTCCGAAGCAGCCGAAGAAACAAGCGTAGAAAATGACTGTACTGAGAAAAAATGCAGTTCAGATGTTATTCAACAAGAGAACAGAAGCAGTCCTGGTCCGTCAATTAAAAATACGGCTAACAAACACGTTGTGCCAGAGAAAAGTAATAAAGGAGTTAAATCTATTTACTTTAAATCAAAGGGATCCAAACACGAGGGGCTCTCACAGGGTGGAGCGTCCGCTGCTGGGCCCTCTAGAAGTAACGGCCTTGTGCGCCATCTCTCTGGGCCCCTTTCAAAAGAGAACTTACAAGGAAAGATCTCCTTGAAGAGAAATAATTCCGACGAAGCTTCAAGGACAACCAAACGACAGAAGCAGTCAAGTATTCTTTCTTCGTTTGGGAAAAAGACGGAAAAAACAGTGGAGGAGACGAAGAAGGAAATTCACTGTCCTGTTTGTGGAGTGAAATTTGCAAGTGAAGCTAAAAATGCAGAGATAAACAAACACATCGATGGTTGTCTCGCTAAATGA

Transcript

OS493_010516-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F4IF36	Protein FORGETTER 1 OS=Arabidopsis thaliana OX=3702 GN=FGT1 PE=1 SV=1
Q5BJL5	Protein strawberry notch homolog 1 OS=Rattus norvegicus OX=10116 GN=Sbno1 PE=1 SV=2
A3KN83	Protein strawberry notch homolog 1 OS=Homo sapiens OX=9606 GN=SBNO1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000611 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13871 all species →	Helicase_C_4	C-terminal domain on Strawberry notch homologue	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR026741 all species →	Family	Protein strawberry notch	Interproscan
IPR026937 all species →	Domain	Strawberry notch, helicase C domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12706 all species →	STRAWBERRY NOTCH-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0031490 all species →	Molecular Function	chromatin DNA binding	Interproscan
GO:0042393 all species →	Molecular Function	histone binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010516-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010516-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

12.7Max TPM

3.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.32	6.57
polyp at pH7 6	18	18	5.01	7.92
coral polyp · control treatment	16	16	3.63	12.66
coral polyp · oil and dispersant treatment	16	16	1.90	9.87
coral polyp · oil treatment	16	16	3.11	5.73
coral polyp · dispersant treatment	16	16	2.16	5.75
Polyp	10	9	2.94	5.43

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.57
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.11
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.87
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.68
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.29
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.12
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.74
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.73
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.97
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.92
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.32
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.73
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.72
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.94
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.92
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.37
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.21
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.14
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.70
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.90
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.85
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.67
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.60
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.66
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.51
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.97
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.52
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.52
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.39
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.31
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.14
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.71
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.53
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.13
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.78
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.34
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.50
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.48
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.20
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.84
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.59
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.56
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.51
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.73
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.64
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.97
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.77
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.56
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.32
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.12
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.48
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.38
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.04
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.63
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.96
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.75
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.52
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.07
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.34
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.96
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.20
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.68
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.47
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.43
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.43
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.18
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.19
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.09
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.29
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.14
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.