Gene detail

Detailed information of OS493_010628-T1 in Lophelia pertusa

Genomic Location: scaffold_26:851324...854707
NR annotation: KAJ7386233.1, hypothetical protein OS493_010628 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010628-T1

ATGGCTCAGGGAGGTCTTCTTCAGCCTCCATTCACCCCTCAACAGTTTGCTATGCTGCAGCAGATTGCTCAACTTCAACTCGTTCAACAGCGTCTGGCTGCGCAGTCTGTTGCCCAGCAACACATGGGACAGAAACAACAAGTGGTGCCTCAGCAACAACTGTATCAGCAACAACAACAGATTGCGCTCATGATTGCTCAGATGCAGCAACAAGTTCTACAGCAGCAGCCTGGTCTGGCAGGGAGGCATCCTGCTCTGCCATTTAGTGCAGTGCAGCAGCAAACTTTAATTCAACAGCAACAACAACAGCAGCAGCAGCCTTCTCCTACTGCACAACAGAAAGGCAATAAACCTGCAACGAATGACAAACCAGTGAGCGAGTCATCGCAGAGTAAGACAGTAGACACTGTTCAATCTCAGCCAAATGAACCTTCTAATGTTCCACCTGTAGCAACAGAGGAACAAATTAAACAACCTTCCCCTGTTCCGCAATCTCGACTAACACAATGGAAGCAGCCGCTATTGCAGGATCCAGGCACAACTGTCACTCAGCCTTCTGTCACTAATAACTCACCAACCTCAGTGGACTCTAAACCTCAAACAGCAGTGTCAACCTCTTCACAGTCCGCCGCTGCTGCTGCCGTGCTTCCAAGTATCGTGTCAGCTCCATCCATTTCTACTAATGATGTGTCTGATCCTTCAGCTCCCAACAGCAACAATGTCTCTCCTCGCACCAGGATTCCCGATCCAGTCTCCAGTAGGTGGGGTGTAGATGCGGGCCCCAAGCTGTCCGCTGACCCACCTGAGTTTAAACCGGGTGTGCCGTGGCGCCCGGCTCCAAGAAACGACAAAAGGGATGAAGGGAGAGATGTTGTTTCTCCTGGCAATGTGGAAGTGTCAAGTCGCCCGTCTTCTTGTAGTAGCGATTCTCCATCAGATAGTTGGTCGAATCCTGGAAACCAACCTACAAGCAGTGTACCTCCTACAAGTGGCGGAAAGGCAGCGGATAATGTTGTCAGCACCACCACAAATTCCGGCTTCTCTGGACTGTCAATCAATAACAGTACATCTGAATCGAATCAGATTGATTTTGGACTGAGCTCAACGCCGTGGCAGTCGACGGACAGTAAAGCCCCAGTCCCATCCCCACCCTCACAAGGAACAAACAAACCAAGCTCCAATGCTGCGTCACTGTTAAGACCTCCCCCAGGTCTGGGGACTACTGAAACTACTCTGCCTGAGTCGCCCCTGTTTGATGAAGAACCTCCAGCATGGTTGAAAAACTTAATAGATGGCTCCAGTCATGGTGGCGAGAAAACCCAGCCTGAATTTCAGTTCAGTCGGTTTGGTTTTGCTAATAATCCTGCACCGTGGAGTCCAAGAGATGCGGGTGTGCAGCCGTTTAGTCCTCTGACACCCAACCCTCAGCCTTGGGCTGCTGTGGGGGGTCCTGCTCCTACATTGTCATCATCAGCATCAGCAGTGTCCATGGTGACAAGTGAGAATGTCCGGCCTGGAAGTGTCAACGCCGCTGAGCCATCTAACCTGCAGAGTTCAGGAATTATCTGGTCTACGAATCAACCGATCCCGAGTGCAGAGGAAAAGGTACCTGGGAGTGTCCCTGGGGCCTCTGTTCCTGCTGTATCTACATCCAGCAGTGTTGCTCCCTCTAGGAACACTGTCAATTCCATGTCAACTTGGTTGGTTCTACGCAATCTGTCACCAAGGATGGACCCCAAGGTTCTCCGTCCTCTGTGCGAGAGACATGGTCCACTACTCACGTTTCAGCTGAACCTGCGTCATGGTAACAGCTTGATACGTTACGGCAGCATGGAGGAGGCCGCCAAGGCCAGGACGGCACTCAATGGCTTGATGCTGAGTGGTACACAGATGGTGGCAGACTTCGCTACAGACAGTGACATCGGCAGTTTCTTTGAGCAAACCATGGACTGGAGCGCGAACCCGTTTCCTAGCAACACTTACGGCAACCAGTGGTCTTTTCAGAACGTGCTCGGATCTGCCGCAACCAGTGAGAGTATTCAAAACCCTCCTAAAGCACCAATAGCGAAGAACCAACCACCAGTGACAAGCACTGAACAGCCTGCCCCAAAGGTCAATAACCCCGCTCCTGGAATGCAATGGGGAGCGCCCTCGCAAGGCCTCTCTGTCAGCGAGCAGTCCTCCAAAGTGAATGCACCCACCGCTCAGTGGGGACCTGGCTCACAAAGCAACGAGCAGCCTGGTACCAAGCCTAACACTGCAGCTCCCAGCGTGCCATGGGGGAGTGCTCCTGGAGCCGCACCAGTGCCGTCGTACTTGTGGGGCTCAGGTCCCTCGCAGCCAGCCCTCGGAGGAAATTATTCCCAGGTTCCAAGCATGTGGTCCTTTCCAGCTGGGGTCCCGCGTGACGTGGAGCCTCAATCAGGATCAGGTGACGGGCTTGTTAGCCCTTCCATGACCACGTTCCTTCCGCCCGGGCTTCTGAACGGAGGAGGAGACCCGGTCTGA

Transcript

OS493_010628-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3UHK8	Trinucleotide repeat-containing gene 6A protein OS=Mus musculus OX=10090 GN=Tnrc6a PE=1 SV=2
Q8NDV7	Trinucleotide repeat-containing gene 6A protein OS=Homo sapiens OX=9606 GN=TNRC6A PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008140 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_010628-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR052068 all species →	Family	GW182 domain-containing protein	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR033503 all species →	Domain	Gawky, RNA recognition motif	Interproscan
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13020 all species →	TRINUCLEOTIDE REPEAT-CONTAINING GENE 6	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0005654 all species →	Cellular Component	nucleoplasm	Interproscan
GO:0035195 all species →	Biological Process	miRNA-mediated post-transcriptional gene silencing	Interproscan
GO:0060213 all species →	Biological Process	positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0035278 all species →	Biological Process	miRNA-mediated gene silencing by inhibition of translation	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010628-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010628-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

78.0Max TPM

46.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	40.77	69.30
polyp at pH7 6	18	18	39.82	55.35
coral polyp · control treatment	16	16	48.97	63.00
coral polyp · oil and dispersant treatment	16	16	59.47	78.03
coral polyp · oil treatment	16	16	51.11	75.68
coral polyp · dispersant treatment	16	16	41.84	53.42
Polyp	10	10	40.69	63.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	69.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.31
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.52
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.51
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.03
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.02
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.73
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.52
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.20
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.96
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.08
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.12
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.69
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.10
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.07
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.08
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.35
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.01
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.20
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.91
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.31
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.56
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.33
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.72
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.33
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.78
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.64
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.16
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.26
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.24
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.85
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.60
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.15
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.15
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.23
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.96
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.51
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.99
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.81
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.92
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.26
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.91
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.82
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.21
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.70
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.68
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.27
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.79
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.69
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.41
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.96
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.83
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.64
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.19
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	75.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.25
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.18
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	63.20
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.97
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.08
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.35
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.77
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.06
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.48
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.81
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.99
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.40
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.34
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.87
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.42
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.65
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.92
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.18
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.22
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.00
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.91
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.34
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.12
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.05
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.83
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.71
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.35
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.66
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	63.69
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	49.77
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	49.11
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	44.34
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	37.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	34.67
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	34.62
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	34.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	30.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	28.21

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.