Gene detail

Detailed information of OS493_010650-T1 in Lophelia pertusa

Genomic Location: scaffold_26:1745279...1772026
NR annotation: KAJ7386246.1, tRNA ligase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010650-T1

ATGAAAAGTAAAGATCAAACTGACGAATCAACTGATGAGAAAGAAGATACGTCTGGAAACACTGGTGATATTGAGATGCCAGCAGACAAAGCAAACAAGAAAAACAAGAAAGGAAAAAAGAGCAAAAGTGTCAAAGGAGATGGAAACAAAATTGAGAAAGATAACAAGGAGGAAGGTACAAACATTGATAAAACAAAAGAACAATGTAGTGCCAGTGGGAAAAGTACAGAACAAGAATCAAAGATGGAGAAAGAGAAGGACGAGAAAAATGATCCACTTAGTAATGAAGAAATCAAGAAGGAAAAGAAGACCAAAGGAGGATTTAATGACTTCTTCTCTCCTAAGAGATCCAAAAAAGCAGACAATAAGGAGGAGAAACTTACAGAGAAGAGTAAAAATGACAAACATAATCAACCATCAAAGAAAGCAAGCTCTTCAAAGAAAACGTCTGATGATGAGGAGTGTAATGGACCTGTCAAACCCACAGAATATTCACCAGAGAAGAACTATTACCACCCCATCAAAAATGCCTGTTGGAAATATGGAGAGAGAGTACCCTACTTAGCTGTAGCAAAAACATTTCAGGCCATAGAAGACACTTCTGCAAGGTTGAAGATTACTTCTATCCTCAGCAACTTCTTCCGTTCAGTTATTGTTCTTTCGCCTGATGATTTACTGCCCTGTGTTTATCTCTGTCTCAACAAGTTGGCTCCAGCATATGAAGGAATTGAACTCGGTATTGGAGAAAACATTCTGATGAAAGCTGTTGCTGAGTCAACAGGACGGAGCCTGCAACAGATCAAATCTGATGTTGGAGAAAAAGGAGATTTAGGGATAGTAGCCGAGTCTTGCCGCAGCACACAGCGCACCATGTTTGCCCCACCCAAGCTAACTGCAGAGGGCGTCTTCACCAAACTAAAGGACATTGCAATGATGACAGGACATAGTTCTATGACAAGAAAATCAGAGAAAATAAAAGGCATGTTTGTAGCTTGCCGTGATGCAGAAGCGAGGTATTTGATAAGATCTCTAGGTGGCAAGCTAAGAATTGGTCTTGCTGAACAATCAGTATTAACAGCTCTGGGACATGCTACCTTCCTCACTCCTCCAAGCAAAGAATTTCCTCCTCCCATAATCGACAATGCTAAGATTTTTTCTGGTGATGAGTTGAAGAAGAAACAAGACGAGGCTGCTTTAATTGTCAAGACCTGCTACTGTGAAATGCCTAACTATAATAAACTGATTCAGTCTATTCTGGAACATGGATTGGAGACACTGCCAAAACATTGTCATCTGACTCCAGGCATCCCACTGAAGCCAATGTTGGCTCACCCTTCCAAGGGAGTTGAGGAAGTGTTCAAAAGGTTTGAAAATGCAGCGTTCACTTGTGAATTTAAGTATGATGGTGAACGGGCACAGATCCATGTGCTGGAAAATGGAGAAATTCACATTTACAGCAGAAACCAAGAAAACAATACATCCAAGTATCCTGACATTATTGAAAGAATGCCAAAGGTATTAGGTGATGGCATCAAGTCCTGCATCATTGATGCTGAAGCCGTCGCTTGGGACAGAGAAAAGAAACAGATTTTACCTTTTCAGATTCTCAGCACACGGAAAAGAAAGGATGCTGATGCCTCAGAAATTAAAGTTCAAGTTTGTGTATATGCATTTGATCTGTTGTATCTTAATGGAAAATCATTCATCAAGGAACCTTTCCGGGCTCGTAGAGAAGCTCTGCAATCATCATTCACAGAAGTTGAAGGGGAATTCGTGTTTGCTCAGAGTTCTGATTCAGTCAACACAGATGACATTGCCGAATTCTTAGATGATTCCATCAAAGGTAATTGTGAAGGACTGATGGTGAAAACCCTTGAAGTGGACGCCACATATGAAATTGCTAAACGTTCGCATAACTGGTTAAAATTGAAGAAAGATTACTTGGCCGGTGTAGGAGACACTTTAGATGTTGTAGTGATAGGTGGTTACCTGGGTAAAGGTAAAAGAACTGGTTCATATGGAGGATATCTACTGGCTTGCTATGATCCTGAGAATGAGGAGTTCCAAACCATCTGCAAGGTGAGATACAAACCGTAG

Transcript

OS493_010650-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P51892	DNA ligase 1 OS=Xenopus laevis OX=8355 GN=lig1 PE=2 SV=1
P37913	DNA ligase 1 OS=Mus musculus OX=10090 GN=Lig1 PE=1 SV=2
P18858	DNA ligase 1 OS=Homo sapiens OX=9606 GN=LIG1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003742 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04675 all species →	DNA_ligase_A_N	DNA ligase N terminus	Family	Interproscan
PF01068 all species →	DNA_ligase_A_M	ATP dependent DNA ligase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016059 all species →	Conserved_site	DNA ligase, ATP-dependent, conserved site	Interproscan
IPR012310 all species →	Domain	DNA ligase, ATP-dependent, central	Interproscan
IPR012308 all species →	Domain	DNA ligase, ATP-dependent, N-terminal	Interproscan
IPR036599 all species →	Homologous_superfamily	DNA ligase, ATP-dependent, N-terminal domain superfamily	Interproscan
IPR050191 all species →	Family	ATP-dependent DNA ligase	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR000977 all species →	Family	DNA ligase, ATP-dependent	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45674 all species →	DNA LIGASE 1/3 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003909 all species →	Molecular Function	DNA ligase activity	Interproscan
GO:0003910 all species →	Molecular Function	DNA ligase (ATP) activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006266 all species →	Biological Process	DNA ligation	Interproscan
GO:0006273 all species →	Biological Process	lagging strand elongation	Interproscan
GO:1903461 all species →	Biological Process	Okazaki fragment processing involved in mitotic DNA replication	Interproscan
GO:0071897 all species →	Biological Process	DNA biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010650-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010650-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

31.6Max TPM

4.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.74	9.43
polyp at pH7 6	18	18	5.37	7.56
coral polyp · control treatment	16	16	5.75	31.61
coral polyp · oil and dispersant treatment	16	16	4.25	30.61
coral polyp · oil treatment	16	16	4.39	10.09
coral polyp · dispersant treatment	16	16	4.16	9.88
Polyp	10	10	3.70	9.36

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.43
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.97
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.96
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.30
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.78
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.61
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.59
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.78
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.08
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.94
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.92
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.31
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.44
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.42
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.22
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.76
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.17
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.11
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.62
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.50
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.39
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.82
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.80
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.61
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.92
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.01
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.13
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.78
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.73
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.56
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.07
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.55
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.61
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.45
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.12
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.02
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.87
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.73
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.49
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.15
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.12
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.52
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.09
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.95
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.92
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.37
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.32
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.78
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.49
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.92
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.86
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.72
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.96
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.60
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.88
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.22
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.13
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.21
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.18
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.90
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.47
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.40
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.36
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.30
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.88
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.39
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.14
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.06
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.25
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.74

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.