Gene detail

Detailed information of OS493_010661-T1 in Lophelia pertusa

Genomic Location: scaffold_26:1901655...1924278
NR annotation: KAJ7386257.1, hypothetical protein OS493_010661 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010661-T1

ATGTTAGAAGATTCCGAGTACATTAAGCTGGAAGGGATTGATGACACCCGCGAAATGTCCCTACGTTTGAGTCTTCTTAATGGGAGAAATTCGCGAAGAATATCTGATAATTCAACGGTAGAGAATCCTCTTCGGAAAAGCATCGATGAAACTGTGGAGCGAAATCCTTGCAAACGCATTGGCTTACATCAGGCATGTCGTGATGGCCTGGCAGATGTCGCAGAACGGCTGATTCAAATAAATCCTTCAGTTTGTAATGAACTCGACAAAGATGGACTCACGCCACTTCACCATGCAGCGAGAGGAAACTTTGTACAAATTATTCAAGCACTGCTTAATGCTGGAGCGGATATTAATACTCCTGGTACTAAAGGGTGTTCATTCATGACACCGCTGATCTGCGCCAGCAAGTTCGACTCGTACGATGCGTGCCGTCTCCTCATTCAAAATGGCGCTGAAATAACAAAGAAAACCTGCAACGGTCAGTCACCAATGCACTATGCAGCTCGTAAAGGACATACTAGAGTTTTGGAGGTTTTGTTACGTGAAGGAGGAGCTCCGGTAAACCATGAAGATAACGACAAAGCCACTCCACTGCACACTGCAGCACAGGCGGGACAGATAGAAGTTATAAGGAAGTTGGTGTTATATGGAGGAGACATGTCACTCCGAGATAATGACGGTTACACTCCACTGCACCTGGCAGCAAGGGAAGGTCACGTGAACGCCTTCAGAGATATGCTGCGAAAAGCCAAAAGTGGTGGTTTGTCAATACGGACATTGTTAAACAGTCCTGATAATTATGGAAATGTTTGCTTACATCTGGCAATTAAAAATGGACACAGAGAGATCGTGGAACTGTGTCTGGAGTCTGGAGCAGATATAAGCACTGCACAGGAGGATTTTTCCACTCCAATTCACTTGGCCTGTAGTCAAGGCAACTTGGAAATAGCAAAACTGCTGGTAAAACATGGCGCTAAGATTGAAAGTGAAGATGGTAATGGCTTAACGCCTTTACTAAGAGCCTCACTTGGAGGACATGTGCCTATCATTGAATTTCTTCTTGAACAGGGAGCGCAGCTGTATCCAACAACAGGAACCTGCACTCCCTCCCCCTTAATGTGCGCTGTGAAACGGAGCCAGCACTACGCTGTCCGGTATTTCTTGGCACGCGGTTTTCCACTGAAGTTTAAGGATCTTAACTGGAGAACAGTACTTCATGTAGCCGTCGCCTGCGCGGACATCGAGACTGTGGACTTGATCTTGGAGAATGGAGGCCATAACCTTTTGGAGAGCAAAGATCAATATGGAAAAACAGCCATGCACTATGCTGCTTCAAGATGTAACGTGGATATTATAAACCGTCTCATCCTAGTTGGAGCTGATGTCAGGGCGAAAGATAACGAGGAACGAATCCCTCTTCACTTGGCAGCAGAGAGTGGCGTCATCGATGTAGTGAGATCGCTTCTCAGCGCATGCCCAGAGTCTGTTAATGACATTGACTATGGATCACGCACACCTTTGCACTGCGCAGCCGCAGAAGGAAGAGCGGAAGTAGCGACCCACTTGTTGCAGAATGGAGCTGAAGTTGACTACAGAGATGATGAACGCTACACACCGATATTTCACGCCGCAATACATGGTTGTCCTCGGACAGTTGATACTCTGCTGCACTACGGAGGGGATATTAATGCCCTTGACAAAAATCGAAAACCTCCCCTGGTGCTGGCAGCTTATTTAGGACACCTGCAGACTTTTAGAAAGTTTCTGCAATCTGGAGCGGATGCAACAATAGTCGGAACAAGTGGATATAACTGCCTGGATGCAGCAATTAGAGCTGGAAGAATGGACTTGTGCATGGAGATAATAAAACACGACAAATGGCGAGAAATTTTGAGCAACAAAAAGAGCGAGGGTGTGTCTCCCATGCGAAGACTTATTGAACGTTTTCCACAAGTTGCCAAACTTGTCTTGGACAAATGTATCGAGCACTCGCCACATCTGGACACAGATCCTAACTACTCGATCACGTACGATTTCAGTTTTGTGTTCCCTAAAGTCGGAGAGGATGTTGATTTTAACCAAGAGAGATACTGTGGAGCAAAGTGTATGCTAAATTTGGGCCGCGAGGAACTGCTGTTTCATCCTCTCACCAGAGAGATGACGCGAATGAAGTGGCAGCGTATTGGTCTGACGGTGTTTTTCTTGGGCGCTGTTTATATTCGATTTTCCTGGATTTGCGATGAAAGTTGGTTGTATTCTCAAGAAATTCTACTGATTCTGTTCTGTTGTGTAAACCTTCTATTGGAAGCTTACCAACTATACAATGAGCGCTGGACGTACTTTGACTTGACTAATTTCTTGGAAGTGTCGACCTACGTGACAACACTAGTCACCATTCTCCCACCAAATGGCAACATCGACGACAAACAGCAGGGGCAGTTTGGAATCATAGCACTGTTACTGGCCTTTGTTGCTATGCTTCTACAGCTACAACTACTTTTCTGTTCAGGGATCTATGTAACTATGCTGTTTGAAGTCCTAAAATCTGTTTTTAAGGTTATTGTTGTGTTTTCCATGCTTATTCTCGCCTATGGATTGATTTTTTTCCTGATGTTGGGAGATGAGTTGTCCTACACGTCTCCATACATGTCCGTTCTGAAGGTGTTTGACATGATGGCTGGCGGTATCGAGTTCAACCATTACTTCGTGGAGAAAGATCTTCCCATGCCGGAGCTAGCACGCTTCATCGTTTTCACTTTCATTCTTATAATGTCCATCTCTCTCATGAATCTGTTGATTGGCTTGGCTGTTGGAGACATTGAATCTGTACAAAAGAATGCTGAACTAAAGCGCCTTAAAACACAGATAGAATCAATCTCTCAATTTGAAGAGAAGCTGCCATATTGTTTTAGAGAGCGTATTTATGTGCCTCGTCTGGTTGTTTGGCCAAATGCAGCTTCTTCCATGTCTTTCATAAGAAAATTAACGTGGTACTTGGGCTGGTAG

Transcript

OS493_010661-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O75762	Transient receptor potential cation channel subfamily A member 1 OS=Homo sapiens OX=9606 GN=TRPA1 PE=1 SV=3
Q8BLA8	Transient receptor potential cation channel subfamily A member 1 OS=Mus musculus OX=10090 GN=Trpa1 PE=1 SV=1
Q6RI86	Transient receptor potential cation channel subfamily A member 1 OS=Rattus norvegicus OX=10116 GN=Trpa1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000226 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR005821 all species →	Domain	Ion transport domain	Interproscan
IPR050889 all species →	Family	Dendritic Spine Regulation and Scaffold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24166 all species →	ROLLING PEBBLES, ISOFORM B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04984	TRPA1, ANKTM1; transient receptor potential cation channel subfamily A member 1	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010661-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

12.3Max TPM

3.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.70	5.65
polyp at pH7 6	18	16	2.27	4.54
coral polyp · control treatment	16	16	4.09	7.40
coral polyp · oil and dispersant treatment	16	15	3.19	5.75
coral polyp · oil treatment	16	16	3.17	4.93
coral polyp · dispersant treatment	16	16	4.60	12.34
Polyp	10	9	3.31	7.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.65
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.33
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.11
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.79
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.75
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.50
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.80
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.72
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.49
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.44
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.44
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.07
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.65
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.40
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.60
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.35
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.61
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.47
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.43
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.27
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.07
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.58
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.03
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.40
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.48
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.28
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.16
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.07
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.28
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.01
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.88
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.50
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.31
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.82
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.57
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.94
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.75
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.43
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.08
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.08
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.75
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.50
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.25
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.00
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.67
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.45
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.33
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.22
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.93
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.35
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.31
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.72
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.39
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.17
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.05
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.88
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.78
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.54
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.08
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.02
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.34
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.17
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.72
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.57
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.73
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.62
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.60
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.30
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.29
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.17
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.66
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.62
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.83
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.