Gene detail

Detailed information of OS493_010845-T1 in Lophelia pertusa

Genomic Location: scaffold_27:1022720...1040560
NR annotation: KAJ7380134.1, Separin [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010845-T1

ATGGAAGGTGAACGAATCTTAAAGTCGCTTCTGAACGCTGAAACAGACGACCTTTACGAGGACACCAAGAATTATCTTGCTCCACTGCGAAGTCCGTTGAAGAATAAAAATGGCTGTAAGGTGGGCTGCAAAGTGGCAGAGGAAACTGTTTCAAAATACACTGTATTTGCCACCAAGTTCCTAAGATGTGCTATTGAGACTTTGAAAAAGGTGAAAGCTAAAGGAAATAATCTTGACGAAGTCACCAAGTCCTTGAATTTAGTGGGTACATTGCTCAATGAGACATTGTCTATTCAGAATGGAACTTACCTCAAGTTTATACCATCACTGGACCAACTTGGCAAAACACTTTATCTGATTATTGCCCAGCTTATAGCCAAGACACAGTTTGACAAGGCATTGTGCCATGCTAACGACCTGCTAAAATTTATTCAACTCCTAAAAACATGGAAAAACTATGACGGCAACAAAATGAACAAGGACCTGGCTACCCTTGCCATGCGTGCGTCTGATGCATTGCTTCAAGGAGCAGGGAAGCTAGAGGAGGTGAAAGTACCACCAGCAAAAAAGGTGTCGCACTTGTGCATCATTTTAGACTGGAGAAGGTTGTCGTTACTTTTTCAAGTGGAAGCAATCACACATTCCTCGCTGAAATCCTTAGTGGATAGAACTCTTCAATGTGGAACAAAATATCAGATGGACTGTGGACAAAAGAATGTTAATTTTAAAACCCTGGCATGCTTCTTTGAATCTGTTTTCAATGCACTTATGACCAAGAGCGAACAACTGATTGCCAATGGGAGAGATTCAATGTTGCTATTAATAGTTGAACTGGGATTTCACTATGGTCGGATTTGCTGCAAAGCGGAAAGATCAACACAAGCCTTGGATGTTTTTGACAACCTTTTAGAAATTGCAAGAAATGGCTACAATTTTGTTGAACTGTGCTACGAATACGACATCGCAAACTCTCGACTCTCCAAGCAGATGTTGTTGGAGAGTAACAGGCTAGTTTCTCAACTGGTGAAGTGTAAGATGTTACCATCATCAATGTTAAAACTGCTCTCGGATTCTATGGAGTATTTCAGACTCACTGTACAAAATGTGTGCAGCAAACAAACTGGCGATAAAACACCAGCTCTCTCGTGGAGAACGTTTCAAGAAGCTGCGCACTTGCTCAAGTTACATGCCGCAGTTCTGTCCTTGCAGTGTGAACAGATCAAGACAGCACTGCGCAAAGCCAATAATGACGACTTGGTTGCACAGTGTAGGCAGCAGTTGCAGAAGACCACAGTTCGACAACTGACTGTGCTGAGTTTTGTGATTTCTTCTTTTCAAGATCAGATGAAATGTGAGAAAAATGCAAAAGATTGTAACCAAGATGTGAGAAGTCACATCATAAGAGATTGTGTTACAGTGGCACAACAAGCAAGCACAGTTATTCACAGTGCTCTTGAAGATCCAGACGTTCCACTGTCTCCAAATGAGCTGCGGTGGTTGGGCAGTACTGTTTACAATGTAGGCTGTGTATCATACCAGAGAGACTGTTTTGCCGAGGGAGTGCCTCTGCTTGCTCTTGCTTGTGATGAGCTAAAAATATGGAGCTTTGCTGCCGAGACCGACGATAAGATTGTCACAAGAATTGCAGAGGTGAAGCTGCTAACAAAGTATGCATTACTGACCGACTGTCAGAGACGCGCCAAACAGCTGAGTGATGCACTGAAGACAGCTACAACTCAGGTCCTGATCACCCTGAGAACAACCACCGATGACGACACCATAAGACAGCAGGTCAAACAATGGATATCAGTTAAACATGAATTGGTAAAGAATCTTCAGGATGAAGAAAAACTGCCTGAAAGATCCAGAACCCTTTGCAGTGCCTTTGCAGAGCAAGAAGATGCTACAGATGTTGTGGGAAGCCAGTTGTGCTTGGTTCTTCAGGAGGAACTTGCTTGCTACAAGGCAAAGAGTTATGACACTGCAGTAGAACAAATTTCAGTGATCAAACAGTTGATGGAACTGTACATTGTTCATGAGGATGAATTTGACTATGGTTCAGCCATGTTAGAACTTGGTGTAGCACTGCATAGCCTAAGAGACGCAGATCTTGGAGAAGACAAGTCTGCACTTGAGTACTGTCAAGAAGCTGGTACAATTCTGGAGCAGTTATCAGACAGGGTAGCTAATGAATACGAGGAGGAAAACTTCCAGTCATCAGTTGTACAAGATAGACTTGCCGCAGCCTATTTGTGGCAGGCCTTGTTGGAACATAAAGATGTGATGGAAGAGAAACCAGCCTCAGCAACGGCGACGCTCAGTGACAGTTATGAAGTTGAAGAGATGGAAGGTGTTTGCCTGGAGCAGCCATTTGTGTCATCCCTTCATTCAGCGTTGCAGACATGGACAGTGTTACGTGATAAATCAGTGCAGCAAGATTCTAATGGAAAGATCGACTTGCAGCACTTTGCCAACCCCGAGGAAACCTACCATTATCTACTCATAACTGCTGCAATGTTTGGACTTTTAAATCAGCCTTTCAAGAAAGTTTGCGCACTTTATTTTGCTGGCAGCATATCCCAAGCTGTTGGCACCAACGATATCCTGGATAGTGGACTGTCTGCATACAGTGACGCTATCCACTCTTTGTGTGACATGCTGGACATTCCACATGCGTCTCTTCTGCTGCGTTACGCCAGTAACTTGGTGGATTCCTTTGAGCCAAGTAATATATCAAGGGTTCAATTCTTGTTGGCCAAGAGTCACTATCTGTTGGTCATGGGAAAGTACTCAGAAGGAGAGGAGTGCCTCAAGGAAGCATTACAGAATGAAGTGTTCACACACAAGAGCTACAAGACTCATCTGTTGAAGGCTAGATTCAAATCTATTTGCATGAAGTACTCAATGCTTCCCACTAAACCTCATGAATTCACTAGTGCTTTTGATCCAGTGCTTGGTTCACTGACTGCCTTGGAGTGTGCTACTGATGGGTTGAATAAGTTAAGTCAAATGGCAGAAGAGATCTTTGGTTTGGATATATTTAGCAGTGGCAAACAGAAGCACAATGAAAATGAGCCAGCAAATGGGCTAGTGATTTCAACAAGTTCCAGTCAAAGCCTTTTCAAATTATCACTCCTGCATGACCTGCTGTCCTCCCTGCTACAAGTTGGCCAGTTATATGCTCATCAGGGTGCTGTGAGAGAGGCCTTCAGGCAGTTTGTTGATGGCATTGCTCTGGCAAGCCAGTTTTCCCTTTCATACAGGATTGTAGAATTTCTGGTCAACATCGCACAGTTGGAAGTGATGCAAGGTAAGGCAGATAAGTGCCAACACAGGCTTGATCAGCTGACGGGAATCTTCCAACCAGTTCTGAAGTCCTCCAGCAAACCAAAGCTCTTTAAAGAAGGCATTCAACAACCACTGTTTATTGAACATCCAGACACGTGTGAATGTGTCATTTGTCTTGATGCTGTACTTCATATGATCTTTATCGATTACTTGGCAAGTCTTTCCAACTACCTCACATCTGTCTCAAGACCTGAGCAATCAAGCCAAGCATTGGAGATGGCTGAGTTGGTTTGCGAAAGTGCCGAGAGCAAGATGATAAGAACTCTTGGGAAACTTAATGCCATTCTGTGTGGTTCAGAAGTTCCGCGTGATTGCAGCTCTAAGGAGACAAAGAAGAAAAGAGGAACCAATTCTGCAAAGGCAGAAAGCAAAAAGAAGATATGGCTGTCACAGAATCTTCTAATTCACAGTTGA

Transcript

OS493_010845-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002281 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_010845-T1 in Lophelia pertusa.

InterPro

InterPro term	Type	Description	Source
IPR005314 all species →	Family	Peptidase C50, separase	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12792 all species →	EXTRA SPINDLE POLES 1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004197 all species →	Molecular Function	cysteine-type endopeptidase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0051307 all species →	Biological Process	meiotic chromosome separation	Interproscan
GO:0072686 all species →	Cellular Component	mitotic spindle	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010845-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010845-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

105TPM > 0

7Conditions

17.0Max TPM

1.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.29	3.30
polyp at pH7 6	18	16	1.33	2.92
coral polyp · control treatment	16	16	2.15	16.99
coral polyp · oil and dispersant treatment	16	16	2.00	16.77
coral polyp · oil treatment	16	16	1.10	3.13
coral polyp · dispersant treatment	16	15	1.05	2.77
Polyp	10	8	0.55	1.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.30
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.23
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.72
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.58
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.40
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.35
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.09
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.03
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.97
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.92
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.76
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.35
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.92
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.74
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.31
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.76
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.60
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.45
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.05
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.16
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.16
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.09
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.73
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.74
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.17
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.10
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.94
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.49
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.42
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.22
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.20
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.77
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.15
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.63
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.61
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.43
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.22
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.81
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.79
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.66
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.55
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.43
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.25
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.20
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.13
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.75
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.68
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.39
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.24
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.79
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.39
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.32
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.77
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.16
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.87
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.06
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.92
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.88
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.81
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.68
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.30
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.20
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.