Gene detail

Detailed information of OS493_010985-T1 in Lophelia pertusa

Genomic Location: scaffold_27:2560501...2606367
NR annotation: KAJ7380269.1, cytoplasmic dynein with WD40 domain [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_010985-T1

ATGAAGAAAGGAAATGTTAAGGCCGCGAAGGCGGATAAGAAGCCTGGAGTCACTGCTTCAAATGCAGCTGTTAAATCAGTCAGTAAAACTGCTGCCGTCAAAGCAAAGAAAAAGGAAGATGATGATGCTACACAAATTGGAGATGATTTGGACGAATGGATGCAGCCAAAACAGCTGATCAAGCCAGATGACCAACTGGAATTATCAGAGGCAGAATTGAAGGAAGAGTTTACTAGAATCTTGACTGCTAACAACCCTCATGCCCCTAGCAACATTGTGCGCTACAGCTTCAAGGAAAAGTGTTATAAGCCAACATCTAGTGTGGACCAGCTCGCAATTCATTTTGCACTTGATGGGAATATGCTTCATAAAGACTCAGATGAAGCTAGAAGACAGCGAGCACGGCAAGGACTGGCAGAAGCTAATAGGTCAGGAAGTGCCTTTACAATACGCAGCCATGGTCAATTACCTACTCCAAAGCATGGAGTCTCTGATCATGACGCTAGTGAAGCTGGAGAAGAGGAAGATAAAGAAAACAAGGCAGAGGCAGTAGAGGAAAAAGCAACAGAAGAGATCCGGCCTGACTCATCTGCCTCTGTGGGAGGGAAGGGTGATTCAAAGTTGACAAATCAGTTTAACTTCAGTGAGAGGGCATCACAAACTTACAACAACCCTTACAGGGAACGTGGGACTTCAACTGAACCTCCACCAAGAGCAAACTTCTCAGCCACTGCTAATCAGTGGGAAATTTATGATGCTTATGTCGAGGACCTACAGAAGCAGGAAAAAATGAAAGAGAAGGAAAGCAGGAAGACACAGTCGTTCAAGAAAGACGATGACAAAAAGAAAAAGCTCATGCAAGTTGAAGTACAGGGTGACGATATTTCAAGGATTTCCAAACCGTGTAAGATAGTGGAGAGAATGGTCAACCAAAACACATTCGATGACATTGCACAAGACTTCAAGTACTGGGAGGATGCTGCTGATGAGTTTAAAGACCAGGAGGGAACGCTCTTACCGCTGTGGAAATTCTCCTGCGAGAAATCAAAGAGAATGTCTGTCACTTCCCTCTGCTGGAGTCCCAAGTACCATGACTTGTTTGGAGTTGGACATGGATCATATGACTTCTTGAAGCAAAGTAATGGAATGGTCACCATGTACACTTTAAAGAACCCTACGTTTCCTGAATACATATGTGAGACAGAGAGTGGAGTGATGTGCTTGGATTTTCATCCTGAACATCCTAACTACATTGCAGTTGGTTTTTACGATGGGAGTGTCGGTGTGTACATAGTTGTACAACACGCAAACAAGATCGACCTAATGTATCGATCAACAGCGAAGACTGGCAAACACACAGACCCTGTATGGCAGGTAAAATGGCAAAAAGATGATCTGGACAATAACATGAACTTCTTCTCGGTATCTTCCGATGGCCGAATAACGCAATGGACAATTGTTAAGAGTGAGCTGAGACACACAGACATTATCACCTTGAAGCAGGGGAGCACTACTGAGGGAGAAGGCGACAGCACACAGCTTCCGAGTCTAGGATGTGGCACTGCATTTGATTTTCATAAAACAATGGACTATATGTTTCTTGTTGGCACAGAAGAAGGGAAGATCCACAAGTGTTCCAAAACATATTCAAGCCAGTTTCTCGAAACTTACGATGCGCATCACATGGCGGTTTACTCTGTCAAATGGAATCACTTTCACCCCAAGATCTTCATCTCGTGTAGTGCAGATTGGACGGTGAAGATTTGGGATCACCACTACCTTGAGCCCATGTTTACGTTTGATCTGAACAACTCAGTTGGTGATGTGGCCTGGGCGCCATACGCTTCTACAGTGTTTGCAGCTTGTACGACAGATGGTCGGGTGTATGTGTATGATCTGAATGTAAACAAAGTACGAGCCGTTATGCGAACAATCAGGAAAATAAATCGCTCGTTTAGCCGCGGCTTTTGCGAGTGGCAGCGGTGCGTTCAATGCAACATTTACAACTTACCTTTCTTCAATCTGGAGACCGTTTCTGGAGTAAGGATGCATCGTCAGTCAATTGCAGAAGAAGTCATAAAACCAAAAGTGGCTAACAAGAAAAGAACGAAGCTTACTCATCTGTCTTTCAATCCTGAGTACCCGGTGCTTGTTGTTGGAGACGATAGGGGCCACGTGACGTCTTTGAAGCTATCACCAAATCTTAGAAAAGCAACGCAGCCCAAGGAGGACATTCCTATTCTTGTACTCACGCAAGCCGCGGATTCTGACGAAGAACCATTATCACCGCCTCCGATTGTCTTCTCTCCCGAGAAAGCCAAGGGACCCGAAAACGAAATGGCAAAAATGGAGAAGTTGTTGAGTCTTGTCAGAGAACCGTCGGCTAAAATTGAATGCCCTGATATTCCACATGACAAGAGAAGGAAAAAATATTTCTTACATACACGTCGGAAACGGAAAGGATCAGTAAATTTCCGTAACTATGGTCAAGATATCGACCTGGTAACTTCAAACCGACGGTACGAAGTTGTCCATGATGGTGTCAACTTTGCAGGCATAATGACAAGTAATTTGACTCTGTACGAGTGTCTTCAACAAGTCTCGTTGGAGAGGTACCATGGAAGGTTTGCACAGCGTGGTATTGTGGATGTTGGAGGGTTGCTGTCGCTTACAATGCAAGATTATCCCGCCTTGGGTATTTCATCAATGGCGGACCGGCAGAATTTGTTTTACTTGATTCAGACGATAAAGACAATGCAGGGCTCACAGTCTAACGAAAGACAATTGCGCAGTGGAGCGACGAAGGATGGTTTGTTACATCTGGAGGGTTCAGCAGTGAAGGGAAAAGGTGCAAAGAGGCCACGGGAAACCACAGAGAACAGTCCAGTGGCTGTCAAGATGAAGTCAAAGACACAGGAGAAGACTCCAGGAACTACAAGGCTGTCTTCTATCTCAAGATCAGCAGAGTCTGTAAACACAGTGGGATTTTACAACTATGGTGTTCCTAGTAACAAGCCTAAACAGTCACCAATCAAAAGGCACCAGCATTCAACATCTGAAGTTGGTCCATCGCGAATTAAAGTGTGTGTCCGTAAACGACCGCTGAGCCAGGCTGAAGTGAATGGCAATGAAGAAGATGTTGTCGCAGTTACTTCGAGCAATACTATTGAACTTACAGCTCCAAAACTTGCCGTGGACCTAACAAAATATACTCAAAAGTATCAGTTTGTGTTTGATGAAGCCTTTGATGAAGGTTGCAGTAATAAAGAAATATATGAGAAAACTGCACAACCACTTATCCAGACTGTATTTAACAGGGGTAAGGCTACATGTTTTGCCTATGGGTGTACTGGAAGTGGAAAGACGTTCACAATGCTCGGAAATGAGGATGTACAAGGGATCTATGTGCTTGCAGCCAGTGAAATATTCACTATCTTACATAATGGAACACACGGTGATGGCCTTGGTCTATGGCTCAGCTTCTACGAGATTTACTGTGGACAGCTGTTTGACCTCTTGAACGGGAGAGCAAGGTTATTTGCCAGGGAGGATGGTAACCACCAAGTCTGCATTGCTGGGTTAACTGAGCAGCATGTTATAGAATATGGTGGTAGTGTAAGGAGCACTGGTGCTACAGGTGTGAATGCTGATTCATCACGATCACACGCAATCTTACAATTGGACGTGAAAGTTGTTAACACTGAGATCATATTGGAAGATCATAATCTTGTGCTGTTGATTTATGACAGATTTTCATTCATTGACCTGGCTGGATGTGAACGTGCCGCAGATGTGACTGACACAGACAAGCAGACGCGTGTGGAAGGAGCTGAAATTAACCAGAGTCTATTAGCTGTTTTGAAGGATTCATTTGTTGGAAACTGTCAAACGTGCATGATAGCCAATATTTCACCCAATAAATCCTGCAGCGAAAACACCCTCAACACACTGCGATATGCTGACAGGGTGAAAGAGTTGAAAAAGGACACCCCAGTAACAGCCTCCCCTCGACCACTGACTGTCCCGACAACCATTGCTGAGACAGACAGGTTATTATCTGTTCATAAGCCCAGTGGATTACCCAGAATGGAAATACAGCCTATTAAGGCTAGTAATGCCTTGGGTCAACTGAGAAGCTCCCCAAGAAAGCTCAAAATGGCAGACATTGAATCGAATGATGGCACAAGACCCAAGACATCAGCTACAACAACATCATCTCCTAGAATTAAAGAATCTATAACAAGGAGCCACATAGGAAATACCACTGGAAATATAAATGCTACTAGTGGTAGTACTGGTACTGTAAATGCAAAGAAAAGACTAGCAGTACATGTACCACCACAAGTGTTGCGGCCTCAGACTTCCCCTGATGTAGTCACAGTAAAAAATCGTGTAGCAACAAATAGAACGCAATGTAGGCTGAGGAATTCCAATTCAAAACGAAAAGCTGGCAATGTCGCACAGATAAATTCTAACTTTTTAACTGAAACTATACAAGAAAAATCTGAAGAAAAACCCCCGAAAGTTGTTTCAGAAAGCTGGCGAAGAACATAG

Transcript

OS493_010985-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q16959	Dynein intermediate chain 2, ciliary OS=Heliocidaris crassispina OX=1043166 PE=2 SV=1
Q32KS2	Dynein axonemal intermediate chain 1 OS=Bos taurus OX=9913 GN=DNAI1 PE=2 SV=1
Q8C0M8	Dynein axonemal intermediate chain 1 OS=Mus musculus OX=10090 GN=Dnai1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003618 (this species only)
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan
PF00225 all species →	Kinesin	Kinesin motor domain	Domain	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR001752 all species →	Domain	Kinesin motor domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR027640 all species →	Family	Kinesin-like protein	Interproscan
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47971 all species →	KINESIN-RELATED PROTEIN 6	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003777 all species →	Molecular Function	microtubule motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0005874 all species →	Cellular Component	microtubule	Interproscan
GO:0007019 all species →	Biological Process	microtubule depolymerization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_010985-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_010985-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

93.9Max TPM

20.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.42	27.67
polyp at pH7 6	18	18	16.59	21.64
coral polyp · control treatment	16	16	25.55	93.85
coral polyp · oil and dispersant treatment	16	16	19.66	71.66
coral polyp · oil treatment	16	16	21.70	32.21
coral polyp · dispersant treatment	16	16	17.08	33.03
Polyp	10	10	23.24	33.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.67
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.54
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.39
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.37
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.68
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.30
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.81
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.18
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.12
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.07
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.81
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.72
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.53
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.27
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.94
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.49
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.64
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.12
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.65
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.28
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.15
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.65
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.38
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.68
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.42
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.98
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.75
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.79
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.38
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.84
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.32
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.85
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.02
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.76
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.45
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.11
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.11
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.31
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.18
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.45
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.63
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.79
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.69
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.85
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.55
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.94
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.66
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.49
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.98
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.15
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.19
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.78
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.74
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.01
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.53
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.44
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.52
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.29
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.92
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.39
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.21
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.43
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.48
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.39
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.09
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.94
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.30
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.12
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.77
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.42
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.24
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.43
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.70
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.77
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.95
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.83
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.03
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.64
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.64
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.08
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.81
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.44
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.32
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	33.95
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	33.62
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	28.02
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	27.26
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	23.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	23.31
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	21.21
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	16.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.59

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.