Gene detail

Detailed information of OS493_011132-T1 in Lophelia pertusa

Genomic Location: scaffold_28:671352...692391
NR annotation: KAJ7373532.1, hypothetical protein OS493_011132 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011132-T1

ATGGAAGCGTGTTCTAATAGAAAGCCTTCAGAAGAAGATCTACTTGGCTGCTGGGAGATAGTGTCATGCAAGTTGTTGGACGACAGTTATCCAGCAGTTGAAGGTGTAAAATTCCACCTTGAAGAAGGTGGTGATCTGATCTGGACAGTGCCACCAGCGTCAGAACAAGAAATGCTTCCTTTCTTTTCTTGTGAAACATTTGTGTTCGACAGTTTTGCAGGAGAGCTGATTTGTTATGGCAGTAATGTAGATAGAATTGCATTGAAATGTATGCTTGATTCAAGCCAGCTAGTCTTGTGTTATGACAGACATTTAAAGCTGTGCTGTCAAAAGGTGAATCAAGTGGATTCTGAGAATCTTTCATCTTGTCCATATTCTCTGCTGTCTGCATTACAGGAAGGATTTTTCACAGATATCACATTTATTGCCAGCAATGGTGAAAAGTTTTTAGCTCACAAGACAATCCTCTCATGTTTCTTTGCTGACATCTATACATGGGACAAAATTCCTCCGTTCCTTGAGAATCTGCCTCCAGATGTGCTGCGTGCACTGTTACACTACCTGTACACATGCTCTCTGCCAAGCAACACCTCAGAGGACACTGCAAAGCAACTATTAAAAATTTCACAATCGCATGGAAAGGATATCGGGAATTTAGGAGAGCTGTGTACTGAGTTTCTTGAAGCAACGGCTGTGAAAAATAGGATTAGAAGCCTGGTGAGCGACTTGTACAGCGTAATGGAGTACATATTACAAATGGCAGAATCCCTCACTACAGGCCCTCGTCATGATAGCACTAACACTCATAGTGTCAATAGCTGTCATATGCATAGAATTGATCCTTCAAAGATCGCTGATGTAACTAAGATGGTGCTTAGGCAACTGGCTATAGGAATGTTAAAGTTTGTTTTGCTCTGTGACATTTTTACCAAACACAAGTCTGATTTATCAAGAGACGAAAGACAAGAAATAATTCAACACTGTAGAAAAAGGTTACCTTGTTTTGTGGAATTAGTGGAGAAGTTCTTGATCATTTTTCAAAGTGCTTTGTCTGGACTCAGTGATTCTGAGAAGGAAGACATGGCTTTGCATCTTATTCCCGAGATTGAGAACATGTGGTTGACATGCACTCAGCTTGGGAGTGATGCTCATCTAGCTCTGGAAACAATCACTCGCAGAGCAGACAAAGATCACAAAAAGAAAACGCATCTTCCAAAGATGGCAACGTCTTTAAGCAGGACTCTGAAAAATGCAGTGCACTTAAGAGAAGTTATAACACTCAAGAGATTTCACGATAAAGTTTCATCATCACTAATGTTTCTATTACAGAAAAGAGGGGATTTTAGTTCTTTGTCAGAAGAACAAAAACTAAGGTCTGTTGTGAAGACCATGGACAAAATAATGCTAGAGATTCCAGAACATATCCACTCTCTTCATAAATTCCCAAGAATATTCGAAAAAAAGATGCCATGGAAAGAGTGGAAGCATTCATGTAAAGTATGGGCATCGTTTGTGAGTCTGGCGTTGCGAAAAGTGTTGGCAAACAAAGACATTCTTGAGCCAGTAGTAGAGCGGACCAGCAGTCTGGTGCATGAAGAAGAATTCAACCATCTTGTCAAAGACCTTGGTTTCCTAAAGGAAAGCTGTAACGATGACAAAACACAAACCACATCCCCGCCGAAGAAGAGCACTGCTCGTGTGGAGTCAGTGGTTACTTGTCCACCCGGTGATAAGAGCCCCTTGGCACACTCAGTCATGCAACTGTTGATATCAGGGGATCAGGCTGACATGAGATTTATTTTAGACAGAACAGACATAGCGCATAACTCCGCCTGTGCAGAGTGTAAACGAATCAGTGAGCAAAACTCGTTGGAGGTTGCTGCGCATCGTGTGATTGTAGCGACGCGTTGTGATTGGTTTAGGAGAGCACTGTTAAGTGGCATGAAAGAATCTATTGAAAGGCGGATCTTGGTTCCTGACACGAGTCCATGCTTATTCCAGAAGTTTCTTGGTTATCTGTACGGCGGTGTGCTGGATACACACAGCCTCAGTCTGGATGACGTCACCGAATTGTTAGCACTGAGTGATAAGTACGAGATGGATTCTCTGAAAGACATTTGTGAAGGGATGTTACTAAGAGATATCGAAGGAGACACCGTTCTACTCTATCTAGGCATGGCTGAACAATTTTCCGTGACCCGTTTAAAGGAAGAATGCCTACGCTTTATAACAATACATCCTGAAGTCATGGAATCAGAATTATTTGAAGAACTTCCGAGCAATTTGAAAAAGGAAATCACAGATAGAATTCATAAAAACATGCCGCGGGTTCACCCGATTGCAGAGGAAGTACATGAAGCTTTTGCTGTAAGTGTTTTAACAAAACAGAAAGTCTTTTTGGGGATGTTGACAAAGGCATTTCATGACTATAACATGAAGTTGGTTACTCCATATAACCATTCACGAGTTACTCATTGGGCCGATTATTTAAACGAAGTCTAA

Transcript

OS493_011132-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007142 (this species only)
Ubiquitin family	E3\|E3 adaptor Cullin RING\|BTB · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00651 all species →	BTB	BTB/POZ domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000210 all species →	Domain	BTB/POZ domain	Interproscan
IPR011333 all species →	Homologous_superfamily	SKP1/BTB/POZ domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24413 all species →	SPECKLE-TYPE POZ PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0030162 all species →	Biological Process	regulation of proteolysis	Interproscan
GO:0031625 all species →	Molecular Function	ubiquitin protein ligase binding	Interproscan
GO:0043161 all species →	Biological Process	proteasome-mediated ubiquitin-dependent protein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_011132-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011132-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

20.1Max TPM

7.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.42	8.39
polyp at pH7 6	18	18	6.25	8.34
coral polyp · control treatment	16	16	10.97	20.14
coral polyp · oil and dispersant treatment	16	16	9.79	17.14
coral polyp · oil treatment	16	16	9.81	13.41
coral polyp · dispersant treatment	16	16	6.97	12.18
Polyp	10	10	4.03	5.86

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.39
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.51
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.70
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.67
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.07
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.90
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.51
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.99
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.97
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.42
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.41
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.39
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.93
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.34
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.70
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.59
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.19
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.09
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.90
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.87
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.11
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.45
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.37
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.13
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.51
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.44
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.92
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.49
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.48
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.13
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.55
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.77
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.18
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.50
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.61
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.41
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.63
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.70
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.04
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.13
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.44
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.74
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.40
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.21
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.83
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.41
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.93
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.10
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.53
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.47
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.45
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.18
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.12
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.35
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.18
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.49
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.52
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.33
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.33
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.49
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.48
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.81
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.15
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.54
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.86
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.11
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.85
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.77
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.43
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.26
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.78
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.36
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.25

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.