Gene detail

Detailed information of OS493_011245-T1 in Lophelia pertusa

Genomic Location: scaffold_28:2017929...2021269
NR annotation: KAJ7373636.1, NLR, CARD domain-containing protein 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011245-T1

ATGGAGATCTTCAAGGATTTCAGGATACCCATGCCAGACACATTCGAATCGCCAAGCCTGACTCACGTAGGGAAATTTCAACGCGGAATTTTGACAGCCGCGCTTTGTATATTGCCTACGTTGCAAGCGATTCAATGGCAGCGGAAACGAAATCATATGGGTTCTGAATTTCGTTGCGGCGTTAGGGATGAAGCTGTAGATACGAGCGAACGACGAGACTTCTTTGCATCGCAATGCTTCGAGGACTACACCAAGAAATACACTGGTATTTCGCAGGGAATGTTTATATTGTTCGTTTTACTGAATCTTTTAATCGTCCACTTCTACATGTCGTACGTTTCCGAACGATTCAATTCCTGGTTTAAACTCAGGGCGACAACACAGCGAGGCAAGGTACTAGCCGACTTGAAGGGCTCGACCGCTGTGTTTAGAGTTCATTCCATTCAACTCGGCATGAAGCTTATGTCTGCGGTGATGTTCGTTCTATACAACTGCCTCGCGCACACAGTTGTTTTGCCATCGGAGAGGGAGTATCAAAAACAATGGACGCCGCCACCTTTTGTGTTCATGTTCAGCGATAGCTCGTTCTCCACTTCAGTTCTATGCTACGCCGATCAAGCGTTCGAGTCATCAATGTTTAATATCGAGCTCGATCTTATCGATGATCTGATATCTTTGCAAGAGCTTCTCAATCTCTCGGCGTTTTCTTCTAGACTGGGGGACATTGTGTACCAGCAGCTCGTTGCAAATCCAGAGGAAGTCCTCCTCATTTTTGATGGTCTCAACGAGTGGACGACCAAGTCTCCCACAGAGCATTCGTGCACAGAAAAAAGTGACGAAAAAATGCCCGTGACTTCTCTCGTTTTGAACCTTCTTTCTGGAGACCTTTTACAGGGATCTACCATAATTGTGACCTCGCGACCAACACCCTTGCTCTCAGAGATGGGAGAAATCATAACATTTGACAGATACGCAGAGCTTAGTTGTTTTAAGCCAGAAGAGCTCAAGATCTGCATCCAAGAGTTTTTCCAGGACAACAATGAGCTTAGCATCACTGTGAAAAATCGGATTTCCAGCGACGAAAATCTCGAAGTTCTTTGTCGTCTACCTCAAAACTGCCTTCTACTCTGTTCGTACTTAGACGTTGTAGCTTCAAGGACAACGTTTGAGCGAATTCAAACTCTCGAGCTACCTTCGACAACGACTGGACTGATCGAAAGATTAATCGAAACAGCAACCACAGCAGAATCGGATCAAAATAACCACAAAACATTCCCATCAGATCATTTTGATTTCTCAAAGAATTCTCAAGAAGTCTTAGAAAAGCTCTCGTATCTCGCATTTGAGGGAATGATCAACGAAAGGTATGTCTTCAGAAAGGAAGATCTCTCACACGTTGAACTGAGCGCTTTTGAGGTGGAAATTCTTGAGGAAGCTGGCTTTCTACGTCGGTTAAGATGCTCTCTACCCCCAAAACCGGACATCTATTGCTTTAGTTGTCTTTCAATCCAAGAGTATCTAGCCGCCAGTCGAATTGTCCAGTCAACCACAACAGGTGATTTCCGGGACTTTCTGGAAAAGGCCAACGAGAATCACTGCGCAACATTGCAATTCGTGGCAGGATTATGCAGAGATGGAAAGAAAGGCAAAGGTATTTTTGTGTGCTTGATGCAACACCTAACCGAAGCTATCAAGCTGAACAGTTTTGTGGATGAACCAGTGATTGACAACCAAGCAATTTCCTTCCTGTGCAAATGCCTCTTCGAGAACGGGACAAATCTGGGTTATCCTTTTGCAAGAGAAGCGACATCTTCTATCTCATCCAAACCCATCGTCTTTACAGAGATTGGCACGAACCCGCCAGTGACTCAAGCGATTCTACACTGCTTGAAGGAAGCTATAGGCAACAATGTAAAGAGAGTGATCTTCGAGAGCAACGCCATGGAAGATGATGGATTCCGCCAGGTGGCCGCATCCATCTGCGAGGAATCCTGCAAATTGGACCAAGTTAAGCTGACAAGTTCTAGCATCACAGATGGCGCTATGTTGTCATTCCTGGAAATAAGTGCAAGCCACTCGTTCCTTGGAATCAAGATTCTCGGATTGAGAGGCAATGATATCTCCAGCGAGGGGGCGAAATATCTCGCTTGCCTCCTCTTCAACGACTGGTGCCATTTGGAGGAACTCCATCTGGGCAATAACAGAATTGGCGACTTGGGAGTGGAATATTTCAGTGAAGCCCTCTGCAGTGGAAGCAGCAGAATTCACACTTTGGACTTGAGTTCCAATGGAATAACCCACAATGGCGTTTTCCATCTAAGCAGAGCTCTGAGTAGCCCAGTTTGTAATGTCAAACGACTGTACCTTCAGAAGAACAAAATTCTCGACTTTGGCATGCAAGACCTCTGCGAATCGCTTTGCACGGGAGAATGCAATCTAAGGGTCCTTTTTGCCAGTTCCAACGAGATCACCGATGACGGTATCATGTTTGTGCAAAGGGCGCTGGCACACAAGTCGTGTAACCTGCAAGAACTCTACCTTGGCTACAATCTAGTGACTGACAAAGGAGTCAAGAGTCTGCTGCAAGCAATGCCTACTCATCAAATCAACCTAAAGGTGTTGTCCCTGACCAACAACCCAATAACGGACGTTGGAGTGAAGATGTTGGCCAATGCCTTGAGAAATTCCAGCTGTAACTTGCACCGGCTTTGTATAAGTCTCGGGCGGGCACAAGTGGCTACCACAAAAGCATCAAAGTTGCAAGTGCGATACGTCAATGCATTCTAA

Transcript

OS493_011245-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7RTR2	NLR family CARD domain-containing protein 3 OS=Homo sapiens OX=9606 GN=NLRC3 PE=1 SV=2
Q5DU56	Protein NLRC3 OS=Mus musculus OX=10090 GN=Nlrc3 PE=1 SV=2
C3VPR6	Protein NLRC5 OS=Mus musculus OX=10090 GN=Nlrc5 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0011570 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17779 all species →	NOD2_WH	NOD2 winged helix domain	Domain	Interproscan
PF05729 all species →	NACHT	NACHT domain	Domain	Interproscan
PF13516 all species →	LRR_6	Leucine Rich repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR041075 all species →	Domain	NOD2, winged helix domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR007111 all species →	Domain	NACHT nucleoside triphosphatase	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR050637 all species →	Family	NLRP family, innate immunity and inflammation regulators	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45690 all species →	NACHT, LRR AND PYD DOMAINS-CONTAINING PROTEIN 12	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_011245-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011245-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

13.1Max TPM

7.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.08	12.34
polyp at pH7 6	18	18	9.40	12.61
coral polyp · control treatment	16	16	8.72	13.13
coral polyp · oil and dispersant treatment	16	16	7.61	12.14
coral polyp · oil treatment	16	16	8.27	12.64
coral polyp · dispersant treatment	16	16	3.27	7.14
Polyp	10	10	5.17	9.11

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.34
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.06
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.03
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.86
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.33
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.49
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.48
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.67
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.47
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.12
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.87
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.70
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.61
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.51
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.45
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.50
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.48
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.29
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.81
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.62
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.50
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.15
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.01
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.57
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.38
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.78
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.13
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.64
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.15
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.58
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.31
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.28
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.25
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.13
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.07
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.49
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.08
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.90
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.07
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.02
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.55
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.02
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.81
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.70
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.52
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.41
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.37
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.95
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.09
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.64
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.03
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.74
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.27
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.36
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.25
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.93
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.84
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.39
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.30
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.83
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.81
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.64
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.14
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.59
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.59
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.33
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.01
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.96
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.58
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.57
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.16
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.52
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.22
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.08
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.30
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.55
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.84
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.95

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.