Gene detail

Detailed information of OS493_011331-T1 in Lophelia pertusa

Genomic Location: scaffold_28:2922238...2935547
NR annotation: KAJ7373722.1, hypothetical protein OS493_011331 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011331-T1

ATGGCGGGGGGTACAAAACATTACCAACAGGTCGTTCGTCAGGGTTTTCTCTGGTGTATAGCGGCTATTTATTTGTTTGCTTTTGCCTCACTGTACGTTCAAATACCAGGTCTTTATGGAAATGATGGAATTCTCCCTGCCAGTTACATATTACATGACTTATCGTCATGCATTGATAAGAGTGCCTCATGTTCCTTGTGGGCTTCTTCAGGAGAGTGTGGCAGGAACACAGCATGGATGATGGAGAACTGTATGAAGTCTTGTAACAGTTGCCATGTATTTGCCAGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGCATATGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATATGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGGCATTTGCTGGCGTATGCGGGCTCATTGTTTCAAAAGACACCTACTCTGTTATGGGTGACTCCGTACCTGGGCTTGGACACGCCCACTGGAATGGAGTTGTTATGTATCGTCGGCATTGTACTCTCAATTTTTCTGCTTGTGTCACAGAGATGTAGAGACTGTTTGGGTTACCTCTTGTTATGGTTCCTGTACTATTCCATGTTACCGGTTGGCCAGATATTCATACGTTATCAATGGGATGCACTGCTGTGGGAATCAGGTTTTCTGGCCTTCTTGGTAGCTCCTTGGAACATTGTTTTCATTCCCTGGAAATGTGGGAAATGCATTTTCTTTAAGTGCAGGCGTTTCAGAAACACCTCAAGGCATCATGACAGCGTAACACTGTGGCTGGTAAAGTGGCTGTTATTTCGTCTGATGTTTGCCTCAGGAATTGTCAAGCTGACGTATATGGACAGAACCTGGTGGGATCTCAGTGCTCTTGACTGGCATTATGAGTCGCAGTGCATCCCCACGCCTGTCGCTTGGTACTTTCAGAAACTTCCCGCCTGGTTCCACAGACTCAGTGTAGTCTTAACGTATGTCATTGAGATCGGAATCCCTTTCCTGGCGTTTGCTCCTGTAAGAATTCTTCGCGTATTTGTTTACTGTAGTGAGGTGTTTCTGCAGTTGTTGATCCTTTTCACTGGTAATTACAACTTCTTCAATCTGCTGACAATCATTCTGTGTATGTCGTTATTGGACGACAAGTTTATTCTCTCTCGTATCCAGTGCCTCCTCTGCAAACCATGCGTGCGCTCCAGCTGTTTCAAGGCGGCAAATCCGCGGACAAAAACCACGCCTCACCCTGGATACACAGAAGTCAAACAAGAAGACAACATGGACGAAGTCGTGGAAGAGAAACCAGACACGAGAAGTAGTAAAGATGTCGAGGAAGCGAGAAATGCTGCTTGTAACGAAAACACAGCGAGTTCGAAGGACACGTCTTCCGCATCGACGGATAAAAATGACCCAGAAGAGGCCTCAACAGCGTCCCAACTGGTGGAGTACGCGTTAGACTGGATGAACACTCGTCACGAAAATCCCAAATTTACTCAAGCTCGAGAATTCTTACACAGCAAGATGTTTGGTTGGATCAAGATGGCGGCTATCTCATTCTCCTTCCTCGCCGTGTTAATAGTTATCATAGTTTGTACTGTCGAGTGGTTTAATATAAAGATCACGAAAAACGAACCAATCCACTGCGAAACAGCATTTACTCCTGAGCAGCTTGTCAATGCAGTTCAACTCGCCACACAGTTTGCAGTGTGGATGGGCTTTTTGTCTCTTCTCATTGAAATACTCGGGACGATTACGAGATGCCTGTTAGAGCAGTGTGGCAGACGCGCCAAGGTGTGGCAGTTGTTCCAGTGTGCTGTTTTCTCTATCGTTGCTTTATTGATGTTTGCCGTTAGCTTGTACTCCTTCACAGCTGTCGATCGCGTCGTCCAGCGGAGTCTTCCTAAGACATTTGTTAATCTGTATCAAGACACTGCTTACCTGGAACTGACTAATGCGTATGGCCTTTTCAGGAGCATGACGGGGGTTGGTGGCCGGCCGGAGCTTAACATCAAAGGCAGTAACTCATTGGAGGGCCCGTGGGAGGAATACAACTTCTTATACAAGCCCGGGAATGTTTTTCAACCGCCTCCATTTGTTGCCCCCCATCAGCCTCGCCTGGACTGGCAAATGTGGTTTGCAGCCCTGGAGTCGTACAGTGAAAATCCTTGGTTCTTGAGCCTGATTCATAAGCTGTTGTTAGGCAAAGAAGACGTGTTACAACTCATGGGAAAAGGTCCTTTCAGCGAATCTCCTCCGCGGTTTATTCGCGCTCAGTTGTATATGTACCATTACACGCAAAACAGCTCCAGCTTGTGGCAAGTTCTATTCCATCCAAGTGGCGAGAAGGCCTGGTGGACGCGGGAGTTTACTAAAGAATACTTGCCATTCGTCGTGAATAACAGCTCGTTATCGATCTTGGAAGACATGCTGGAGAAACACGGAATTTACAGGCCAAATTTTAAGCCAGAGGTCACGTGGGGCTTTCTTTATCCTTTCATCCGGGACTTGAGAGAAGCTCACAGACGAGTAGCGCCCACTAATGTCATCAATGCCCTCCTCTTCACGGTGGTCACGTGTCTTGTGCTGAAGGTTTGGTGGAGGAGGACTGGAAGGAAGTTCTGCTCTTTAAGAGTTCGCGACAAGAGTAAGGCGCCCTTGAAAGACGCTGACGAAACAGAGCATACGGATATACAAGAATCCTCCAACAGAGACGCAGCTTGTGGGAAATGTGTTTATTGTGTTGCTTACATGGATAAACTGCGTGCGATGTACAAGAAAATTCACAAGGAAATTACCAACTGGTGTGCGCTTGTATACTGTAAACTTCAAGAAACATACCAAAGATGTAAAGCTTGGTGGAAGAGTAGAATGCCTTCGGTAAAGAAAAAAGCGTAA

Transcript

OS493_011331-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZKZ9	Lipase maturation factor 2 OS=Gallus gallus OX=9031 GN=LMF2 PE=2 SV=2
Q0P4Y8	Lipase maturation factor 2 OS=Xenopus tropicalis OX=8364 GN=lmf2 PE=2 SV=1
Q7ZWN0	Lipase maturation factor 2 OS=Xenopus laevis OX=8355 GN=lmf2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001525 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01549 all species →	ShK	ShK domain-like	Domain	Interproscan
PF06762 all species →	LMF1	Lipase maturation factor	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003582 all species →	Domain	ShKT domain	Interproscan
IPR009613 all species →	Family	Lipase maturation factor	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14463 all species →	LIPASE MATURATION FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005789 all species →	Cellular Component	endoplasmic reticulum membrane	Interproscan
GO:0051604 all species →	Biological Process	protein maturation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14637	SLC15A2, PEPT2; solute carrier family 15 (oligopeptide transporter), member 2	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011331-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

9.8Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.56	8.81
polyp at pH7 6	18	18	5.72	9.14
coral polyp · control treatment	16	16	4.57	8.64
coral polyp · oil and dispersant treatment	16	16	2.88	4.65
coral polyp · oil treatment	16	16	4.81	7.64
coral polyp · dispersant treatment	16	16	2.23	5.43
Polyp	10	9	5.22	9.78

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.81
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.95
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.04
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.59
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.56
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.39
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.68
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.44
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.25
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.86
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.35
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.24
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.81
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.68
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.14
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.63
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.23
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.98
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.85
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.42
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.35
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.99
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.68
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.98
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.97
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.13
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.07
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.24
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.60
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.08
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.85
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.72
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.64
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.44
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.58
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.43
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.32
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.13
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.96
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.49
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.82
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.94
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.72
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.43
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.35
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.74
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.67
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.55
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.03
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.61
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.60
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.57
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.40
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.92
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.81
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.94
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.24
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.02
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.43
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.58
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.54
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.63
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.10
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.02
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.97
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.94
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.78
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.73
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.72
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.40
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.30
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.