Gene detail

Detailed information of OS493_011547-T1 in Lophelia pertusa

Genomic Location: scaffold_29:2326089...2345728
NR annotation: KAJ7363265.1, hypothetical protein OS493_011547 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011547-T1

ATGCTCGCTCCAAAGGCGCTGAAATCAGACAAGGGTCAAAACTCTGATCGACCCGACGTCGGTTCTAGCTCGGAGATTTCAGAAGATGATACTCCGCTGGACGCGCGTTTGAATTCGCAGGGAGCTAGTCGACCAAATGTTGGAAGAAAGCAACGTCAATTTACTGCTTTATCTGCAAAGAAAGGAGGGTTTGTCATCCCAAGAAAGAAGAAACAACCAACCGAACTTCTCCAAATTTCCAATTTCAATGCGAGAGAAGGGAAGGAATTACTTCGACATGTTGACCAGTCCTACCGCGACCCTCTTGTGGGAGCTACGTTCAAATTCGAAAAGCTAGAGTTTGTGTTCAACGATCAACTATCCAAAGAGTTCCAAGACAAAAAGCAATCGATGCGAAACGAGTGGCGAAACCCAAGGGAGCCGCTTGAAGATAAACATGCGTTCCTCTACACTGTTGATCGGGACGAGGTGAAGAAAATTTGTGAGGTGGGACTTGAGGCTGGGTCAACATCATTATCTTGTCTGGGAGACCCCTCTATGGGTGTTTATCTTTGCCGCCATGCTGATGTGATATCCAAAAAACCTCTACTTCCGAGTGCACTGGGATACCTGATTGTTTTCAAAGTCATCAAGGGTAAAGTAAAACCAGTTACAGAAAGGAGTGCTACAGCTGCTACAGACCTGCTTGAACCAACACCAAACTTTGACTGTCATGTGTCCAGATCCATCCAAAGCCTTCCAGCTAACAGTCTGCCGAGCCAAGTGTTCGAGTGTTCACAGTATTATTTCTATGAGTTTGCTGAGGAGGGTGACGATCTTCATGTTAAAAGACCCAGGCAATGTCTTCCTTATGCTCTTCTTACTTTTACCATAGAAGACTCATCTACTTCTCATCAAGAGTCTTCTGTTGTTGTGCAGGAGGAGATACCAAGTCTACTACATGCAGACATCAATAATGGATTCCTACCTTCAGCACCATCTATAGTGAGACATGAACCAAGAATCCTAGAGAAGAGACGAGGAAAAAGCAGCAGCCATGTTATTTGGATGGGAAAGATAGCCAACAAGGACAGAGTGTTGGCTGATGCCCAGCTTGTTTGTCATTCTGGACAAAAACTCAAGCTTCCCTTTGAAATTGGTGAAAAGATTGTGATGAAAGAGAAAATCTCCTTTCAGCAGCTGAGACCGTTCTTGACTTTCCCTCTCTTTCATACTGGTCCGCCATCTGTATCAAGAGTTTGCAAAGCATCCTTGGCCGGTGGTACTAGTTTCTTGCACTGTGATTTACTTCCAGTTGAGGATGATCATGGAAAAATTGAAAAACTTGTCAAGTTTTTCCAAGAGAAAAATTGGGCTGGAATTGTTAAATGTCCTGATGCCAACAAAGTGATATTTCTAATACCCACCTCTCAAGTCACTTTGGATCTTGGAATCACCACAGTAGATTCGCCAGCAGCGCTTCATGTTCTCCTCTTTGTGAAGAAACAGACAACTGATAAAGGCAGCACAGTCAACAAGACAACAGCAAGTGGTTCCGTGAGGGAGAAAGATTTGCGTGAAGTAAAGACAGTCAGCCAAATTCAAAAGGAACTGAAAAGAAAGTTTAGTTTAAAAGGTGATGTAAAGAAAAAGCCCACTGAACATAGAAGACTCAGCTTGGATTCTGCAAGAGAGGCAGTTGCATCAGCATCTAGTAGCAACGAGACACAGCAACCCTTTGAAAAGGGGTTGACAAGTGAACAAACAGTGGTATGGAAACATGCCGTAGAATCGTGGCTTAGCAGGCCGCATCCCTTAGGAGGTGCAGAAGCAGATTTGCTAAAGACAACAGCTGGCGGTGAAAGTGTTTTGAAAGCCTCTCAATTGTCCTCCTCTGTAGCTTATGTTCCAAAGCCCCAAGTGCCAGCTGCAGTGATGTCACTTAATATTCCTGTTCAAGATGTGCATGCAAGATCTTCATGTAGTGGTAGCACAGAGCAACATAGACTGTTTTCTGGGCAGCAAGACTTGCAGGCAAGATCTAGTGGTAGCACAGAGCAACACAGAGTGTTTCCTGGGAAGCAAGACTTGCTGACAAGATCTAGTGGTAGCACAGAACAACACAGATTGTTTCCTGGGCAGCAAGACTTGCAGGCAAGACCTAGTGGTAGCACAGAGCAACACAGAGTGTTTCCCGGTCATCAAGACTTGCTGGCAAGACCAAGTGGTAGCACAGAGCACCAGAGAGTGTTTTCTGGGCAGCAAGACTTGCAGACCAGATCTAGTGGTAGCACAGAGCAACAGAGAGTGTTTTCTGGGCAGCAAGACTTGCAGGCAAGATCTAGTGGTAGCATAGAGCAACACAGAGTGTTTCCTGGGCAGCAAGACTTGCTGACAAGATCTAGTGGTAGCACAGAACAACACAGATTGTTTCCTGGGCAGCAAGACACTTGCTGGCAAGACCTAGTGGTAGCACAGAGCACCAGAGAGTGTTTTTCTGGGCAGCAAGACTTGCAGGCCAGATCTAGTGGTAGCACAGAGCAACACAGAGTGTTTCCCGGGCAGCAAGACTTGCAGGCAAGATTTAGTGGTACCACAGAGCAACACAGAGTGTTTCCTGGGCAGCAAAACTTGCTGACAAGATCTAGTGGTAGCACAGAGCAACACAGAGTGTTTCCCGGGCAGCAAGACTTGCAGGCAAGATCTAGTGGTAACACAGAGCAACACAGAGTGTTTCCTGGTCATCAAGACTTGCTGGCAAGACCTAGTGGTAGCACAGAGCACCAGAGAGTGTTTTCTGGGCAGCAAGACTTGCAGGCCAGATCTAGTGGTAGCACAGAGCAACACAGAGTGTTTCCCGGGCAGCAAGACTTGCAGGCAAGATCTAGTGGTAACACAGAGCAACACAGAGTGTTTCCTGGTCATCAAGACTTGCTGGCAAGACCTAGTGGTAGCACAGAGCACCAGAGAGTGTTTTCTGGGCAGCAAGACTTGCAGGCCAGATCTAGTGGTAGCACAGAGCAACACAGAGTGTTTCCCGGGCAGCAAGACTTGCAGGCAAGATCTAGTGGTAACACAGAGCAGCACCGAGTGTTTTCTGGGCTGCCTGCTGAGGCTCAATCAAGGCAACTGAAACAGGACAATGTTATCAAGAAAGACAGCAAGCCATCTGTCGCACCGCTTGTGATCAGAAAAGAAGAACACAGAGAAGATCCCAGGTTAAAGATGAGGCGTCCTCTCGATGAAGAACCAAGCATAGGGTTCAAACCTTCCAATGTGCCGAAGCCTAGTCATGGCACTCCATACAATGCACAAGAAGCATCAAATGCACAAAGTGTAAAATTGGATTCCATCTCTGTCCCATCAGTAGCAATGTCAAAATCATTGTCTACTAGTCAATATTATAAGTATCAAGTGAATGATAAATTTTTAAGGGAGGTGTTGGAGAAAGTAAAATCACAACAGGGAGAAGAATCAGCTTATAAAGTAACTGTTAACGACGGCACAAGAAAAGCTTTAGAAATGATGAAGCAGCAAGAAGGGGCAAAGAGTAGTAAACCTGAGTTGCAGGATGCTAAAATGAACGAGAGGAATGCAAAACCTGTTGGTAAGTTGGTGACTACGATATGCACAAGTGATGAGAAGTCTGTCAAGCGAAGTGGCAGTAGTGTAAGTGCAACACAAGAGAAAGGAAAAAGAATTAAAATTGATCAAGGCAATCCAGTAAGTGAAAATGTGTCAGCAGTGACAGCAAGAGTGCCAACACTGCCATCAGCAGGACAACCCACAAAGTATAATGAAAGCAGAAAAGGAGAAAAACAGATACCTGCAAAAAGATCTGGAAAGAAACCGTGTGTGAAAAAACAAGTGAAAGAACCCCCAAAACACAAAGATTCATCAAGTGGGCAAGAAATAAAAAAGCCAGTTGTGCAGACCCCAGTGCCAGAGTTGTTAGAGGCTCCTTTTCCAGCCATTCCGACTTGTAATACTCTGACAAGCCCTCCATCAAGTTCTAGTCGGATGTCCAAAGCACCCAAGTTGAAGTTGATATTGGCATCAGATAAAAGAGACCTAAAAGAAGTTTCTGCACAGTTGCCTAGTGGTGACAGCGATGAATCATTTGAACACAAACCTGAAAAGCAGCCCATAGAAACAGAGCATGAGCAAAACGGTGACTTACAAAGAGACAGAAAGTCAATTGATTCACCAGTGGCCATGGATATAAGCCCTCAATATACTACCACACCATGTCTATCAGGATCTGTTAGTCCTATAACTGTGGTCTCCTCAAAAGGGCGTTATCAGTCACCAGTACCTCCATCAGCAGCTTCAACAACTCCAGTGCATTCATCCCAGGCATATTCATTACCAGTGTCTTCAGGTTTTCCATTTACTCCACCAATTCCTCAAGGTCCTTATAGAAGTTCAGTAGGCATTGGGCCTTTTTCAAGTCAGCCAAGACCTCCTATAAGCCAGCCACCAGTCAATCCCATGCCATTTGTTCCTCCCTTGTCATCTGCATTGTCCAGTGGGACAATTCCATCTCTGCCTGGTGCTCTGCCTGTATTACAAAGTCCTTCAGTGTCATCTGCTCCATCTGCTGGATCTCTGCCTTTTGGTACTCCCATGCAAGCTGGCTCGTCTTTTATACCACATTCTGCCATTCCACCAGGGCCTGTTGTTTCTCCAGCTATTTCTGTACCACTTACAATGGGGACTTTTGCTGGCAGTCCATCATTTCCACCCCTACCACCTGCACGTCCAGCCAGTCACCAAAGGAAAAATAGTTTGGATGCATTATCCGATGTTGTGTCGTCATTGGGCGGACAGTATTCAATAACATTTCCTGGTCTTCCACACAATCAGAGGTTTGGATTCCCAACAAACATGGCTCCTCCAGGAGTAGTTGCCATGTCACCAAACACCTCTCTACCACCGCCAGTGCTCCCACCACCAGCCGGGAGACCTCCTCATGTTTTTCCACAACAGTTAGGAGGTCCTTCACAAAATACACCCTTTCCTGGACCTGCAGCCAAGATGACTGTTGTACAACCACAACGAGTAGGATTTGTGCCAATTGGAATTCCAAGATTCCATGTACAACCTGTGCTTCCCACTGGACCAGCCTCACCCCAGCTTGGTGGTGTGTCTGTGGTACCACAAATGAACCCAGTGCATCCCATGTTTGGTACAGTGCCTTTGCCACGTCAATTCCAACCCCGCCTTCCTTTTCAACAGCCACCTCCTGTCGGGTTTTGGGTAGCTCCTTTTAAGATGCCATTTGTGCCCAGTGGAATATCAACAGCTCACATGGGACGAATGCCCTATCAATCTGCAGGACAGAAGCATCCCATGGAGTCAAAATCATCACTGCCGCAGAAAAATGCAGATCCTGAAAAAGATCTTGCCAAAAAGGATCTCAGTGTTGGAAAACTACTAAAAGAAGATGAAAACCAGAACAATAAAAATTCCAAGGACACTGGCTCAGAAGGTCCAAAAGGAGATGCTTCTGACCAAAAGGCGGTTGACAAAGCAATATCAAGTGCAGAGTTAGTGAAGCAAAAGGAAGTTGCTTTAAGCAAGTCAGAACTGACTAGTGTTAATAATCCAAAAGAGAACAAAGCTATAACAGCTAGTAGCAATGACAAGAAAGCAACCTCCAGCAAAGACAAAGAGATTACAAGTGAAGCGGTAGATGAATCTGTTATTGGCAATGTAAAGCAGCTTAGTGGAAACACAGAGGAGGAAAAAGTCGAGGATTCAGAAAAACTGAGGTGTGATCAGACATCAGATTCTACCTGCAGTAAAGAAATGCAGATAGAATAG

Transcript

OS493_011547-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q69ZR9	Protein TASOR OS=Mus musculus OX=10090 GN=Tasor PE=1 SV=2
Q9UK61	Protein TASOR OS=Homo sapiens OX=9606 GN=TASOR PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003273 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12509 all species →	DUF3715	Protein of unknown function (DUF3715)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR046432 all species →	Family	TASOR	Interproscan
IPR022188 all species →	Domain	TASOR, DUF3715	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16207 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005654 all species →	Cellular Component	nucleoplasm	Interproscan
GO:0045814 all species →	Biological Process	negative regulation of gene expression, epigenetic	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_011547-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011547-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

45.4Max TPM

6.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.61	10.85
polyp at pH7 6	18	18	6.34	9.97
coral polyp · control treatment	16	16	9.77	45.41
coral polyp · oil and dispersant treatment	16	16	6.76	26.55
coral polyp · oil treatment	16	16	6.29	14.29
coral polyp · dispersant treatment	16	16	5.50	16.55
Polyp	10	10	1.07	2.12

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.85
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.76
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.38
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.26
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.53
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.33
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.00
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.63
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.37
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.58
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.42
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.39
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.11
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.97
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.96
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.64
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.58
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.33
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.57
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.26
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.63
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.49
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.19
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.10
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.85
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.93
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.78
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.91
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.78
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.53
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.11
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.04
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.38
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.58
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.48
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.31
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.55
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.24
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.76
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.50
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.10
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.79
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.90
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.25
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.03
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.05
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.33
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.68
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.40
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.29
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.48
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.58
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.51
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.09
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.89
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.81
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.41
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.29
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.68
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.14
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.06
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.70
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.04
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.56
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.97
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.58
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.14
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.32
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.56
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.12
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.77
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.50
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.08
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.46
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.31

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.