Gene detail

Detailed information of OS493_011551-T1 in Lophelia pertusa

Genomic Location: scaffold_29:2402855...2409754
NR annotation: KAJ7363269.1, hypothetical protein OS493_011551 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011551-T1

ATGAGCTGTAGAGCGTTTCGTTTTGGTTTGCTGCTCATTTTACTGGCACTCGCCGCGGGTGAAAGGCAACAAAGCGACGTGAAGTCGATTGAAAGAATCGACAACGCATTAGCAGTTGTTGGAAGGGTTTTTGTATATTCTCTGCCAAACGAGGGTGGCCATAAAGACACTACATACGAGGTTGTTCAAAGAGGACAAGCATCTTTACCTCAATGGCTCTCATACAACGCGGACAAATCGTTGCTACTTGGGGTACCATCATGGCGTGACAGAGGTGACGTTATCGTCGATTTTCAATCTAAGGACGGCAATGTGAAATATTCTTTGAAAATCGAGGTTAAAGACCTGCGTGACGGAGCGTTACAACCTTCATCAAGCTCCAACAGTACCAAAACCTCTTCGTATTCCAAACCAAAATGTCCCAAGGGATTACCAGTGGTAGCGGCCTCCATTGTGTTGGATTATCACTTAGAGAAAGTTACGGGACAAACGAGAGTCAACATCATGAACAAAGTGGGTGATTTTGTCGACGTGGATGTGAAAAACCTTCACATGTTGGCGGGCAAAGGTCACAACACAGCATTTGGGCTCAAAGATGTGAGAACAGTTACTGCAGGACCAGGAAATGTGGCGGATACCAGGCAGCCTGGTGTGGTGGTTTCCTGGCAGATTGGCTGTGGTGTCGATATATCTATTGCTGGAGTAAAAATAGCCTCTTTCCTCAAATCAAGTACAGAGACAGGAGCCTTTGGTCCAGTGCTTGGTCTCCCTGTGACTGACTGGCACGTGTCCATTGGTTACCCCAAAGAACCTCGGCAGCGAGCCCGCAGGCAAGCTGTACAGGACAAAACTCCGAAAGTCGTCAAACGATCAACAAAGAGAAACGTTCGCGCGATTCAAGCGACTCCTACGCCGACCATGACTGTTGCGCCTCCAACCTCGATCATCGCTAGTGTCACAGTAACTGTTACCAGGACAAGCTCTGTTGTTCCGACATCAACGGTGGTACCGACTACAACTCCGGTGGCGCCGACGACGACCGAACGACCGACGACGACGGAACCGACAACTACAAAGCGACCGACCACGACAGAAGAACCGACGACCACGGAAAAACCGACTACTACCAAGCCACCGACCACGACTGAAAAACCGACTACTACCGAACGACCGACCACTACCGAGCAACCGACCACGACTGAAAAACCGACTACTACCGAGAAACCGACCACCACGGCGGAGCCGACTACGACTAAACAGCCGAGAATTACAACCAAGCCACCGACCACGACAGAAAAACCGACTACTACCGAACAAGCGACGACAACATCACCTCCAACCACAGCAGAACCAAGCACCACAGCCACACCACCTCAACCGCCTCGTTCCACGCAAAAACCATCAACAACAGAGAAAGTTACAACAGTACCTTCTACAAAAGTGGAAAAACCTACAACTGATGACATTCCAGTTGTGCTCAATCATTTTGATCGCCTGAATGTCTACCGCGGCCAGGGATTCCGAGTCCACATACCCTGGGACACATTTCATGATAACGAAGACGGCTTTACGCCTAATCTGACGCTGTCGATGAAGACGATCGATTGGAAGCTGTTGCCCAAGTTGTCATGGATTAAATTTGACTCTGATGAACAAGTGATTTATGGGTACCCTGTGGACGAGGAGACCATCGGCATTCACGAGTTTGTGATCATTGCTGCTGATAAATATGGCAAAGAATACTATGACGCTATCGAGGTGAACGTTATGGATGATTCTTCCGCTGCTTACAATCATCGCTTTGCTCTGGAACTCGATTATGATTACGAGAAATTCACCAGTGACTTGAACATCCAAATGCAACTCCTATCCAAACTTGCGCAGTATTTTGAAGTGAATACGAGCAGTATACGGACGGTCTCGATTACCAAAGGCTCCGTGCTGTTCAAGTTCCAATTCGACTCGTCTGCCGTCCCGTACGATGTCTGTGATTTTGCTTTGAGGGAAAAGTTTCTCTCTGAAGATGATGACGGAGTGAACTCTGATCTAAATGATGCTCTTGGGCCCGAGTTTCCAATCAAATCCGGCTCGTTTGAAGGCTTAGGACCGTGTAAAGACGGCGATGTTGTTGATCCCCTACCAGCACAGAGCTCGGGTGTATGGAAAACCTACATCATCATCCCGGTGGTCATCTTAGCAGTTGTGTTGTTGGTCATCGGAGCATGTCTTTTCGTTATCGTGCGCTCGCGCCGAAGACGCTACAAGCTTTCAGAAGACGATCAAAAACTGTTCGTGCAGAAACTCAAACCCGCCGTTCTCCAGGAAGAGTACGAAGTTCAAGAAAGGTTGCTTAAACAGCCGCTTGTCCTGCCAAACGAGAAACCACCCCTCGCCCCAGCGGTGTACCCGCGCAGCCCGTCCCTGAAGCACGGCTCTACCACGGAGCCGCCCCCGTCCGCCGGATACCAGGCCCCCTCCTTCACCTCAAGCAGACAACCCAATAATCCAGTAACCCCCGGTGGGAACAGCCCTCGGAAGCCCGGGTATTCAGGATACCGGCTACCCCCGGCGTATGTGCCACCGTAA

Transcript

OS493_011551-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q62165	Dystroglycan 1 OS=Mus musculus OX=10090 GN=Dag1 PE=1 SV=4
O18738	Dystroglycan 1 OS=Bos taurus OX=9913 GN=DAG1 PE=1 SV=1
Q9TSZ6	Dystroglycan 1 OS=Canis lupus familiaris OX=9615 GN=DAG1 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002155 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18424 all species →	a_DG1_N2	Alpha-Dystroglycan N-terminal domain 2	Domain	Interproscan
PF05454 all species →	DAG1	Dystroglycan (Dystrophin-associated glycoprotein 1)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027468 all species →	Homologous_superfamily	Alpha-dystroglycan domain 2	Interproscan
IPR030398 all species →	Domain	DG-type SEA domain	Interproscan
IPR006644 all species →	Domain	Dystroglycan-type cadherin-like	Interproscan
IPR041631 all species →	Domain	Alpha-dystroglycan N-terminal domain 2	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR008465 all species →	Domain	Dystroglycan, C-terminal	Interproscan
IPR015919 all species →	Homologous_superfamily	Cadherin-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21559 all species →	DYSTROGLYCAN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0002009 all species →	Biological Process	morphogenesis of an epithelium	Interproscan
GO:0007411 all species →	Biological Process	axon guidance	Interproscan
GO:0016011 all species →	Cellular Component	dystroglycan complex	Interproscan
GO:0016203 all species →	Biological Process	muscle attachment	Interproscan
GO:0021675 all species →	Biological Process	nerve development	Interproscan
GO:0042383 all species →	Cellular Component	sarcolemma	Interproscan
GO:0043236 all species →	Molecular Function	laminin binding	Interproscan
GO:0016010 all species →	Cellular Component	dystrophin-associated glycoprotein complex	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06265	DAG1; dystroglycan 1	-	Viral myocarditis	ko05416	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011551-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

110.2Max TPM

19.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.50	23.04
polyp at pH7 6	18	18	19.72	31.88
coral polyp · control treatment	16	16	26.98	43.06
coral polyp · oil and dispersant treatment	16	16	19.28	44.43
coral polyp · oil treatment	16	16	24.20	110.19
coral polyp · dispersant treatment	16	16	19.65	49.53
Polyp	10	10	8.72	15.80

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.04
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.54
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.66
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.52
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.66
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.69
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.08
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.47
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.39
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.24
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.23
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.29
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.23
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.06
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.03
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.67
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.47
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.60
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.12
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.09
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.09
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.95
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.50
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.37
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.99
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.06
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.06
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.41
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.24
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.26
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.90
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.08
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.81
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.21
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.82
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.03
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.30
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.43
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.43
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.25
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.07
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.47
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.40
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.29
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.66
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.50
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.93
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.92
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.75
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.35
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.55
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.19
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	110.19
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.03
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.14
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.81
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.69
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.31
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.86
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.29
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.15
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.09
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.85
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.75
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.90
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.53
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.74
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.40
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.53
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.18
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.24
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.09
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.61
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.24
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.01
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.49
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.42
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.80
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.64
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.66
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.94
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.83
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.67
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.11
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.42
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.41

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.