Gene detail

Detailed information of OS493_011587-T1 in Lophelia pertusa

Genomic Location: scaffold_29:2777941...2793554
NR annotation: KAJ7363302.1, Rho guanine nucleotide exchange factor (GEF) 17 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011587-T1

ATGGAGCAATGTTCCCGAGATCACAAAGAAAAACTGACCCTTCAAGACTTGATGATCATGCCAGTGCAAAGAATTCCACGATATGAACTGATACTAAAGGACATGATAAAACACACTCCTCATGATCACCCTGATCACGGCAGTCTTCAGCTCGCACTGGGAGAGATAAAGACGTTAGCAGATAGAATGAACCGAGGAGAGAAGGAGGTCGATCAAGCAGAAAGAGAGGCCGAGAGGCTGCGTGATCTTGAAGCAACTATTGAGGGGATGGCAAATTTGGTGACTCCCACTCGACGATTAATACGTCAAGACTTGGTAGCTGAAGTGAAAGGAAATATGACCAAGAAAGACCGATGCCTGTTCCTGTTTAACGACATGCTAGTTTGTGCAACTGTCAAGCGAAAGGCGAACGCTCTCAGAAGAGGCTCACTAAGCATATTTTCTGGGTCTGGCACAGAATTCAACAAATACAAACTACTCTGGAGACTACACCTTGATGATGTGGAAGTCTACAAAACATCTCCTGAAGCCCAGAGACGGAACAGTCTGGAGAAGCAGTTAGAGAAACTTGACAATGATATGTCATTGCTGAGTAGGATCAGCATCTTGTCTGATACTCTAACAATAACACACATGACCCTAGATGGAGCTATCCGAGAACTGATGAATGAAGTCAATCGGCAGATTACTGAGAAGCAAATTCCATTACAGCCTTCTACTTCGACAAAGTTAGAACTACATGTTACACAAGCAGAGGAGGATGGCCCTGAGGAAAAAGATTTTCAGTTTTTGTTCTTGGAAACAGAAATAAAGAATTCCTGGGAAGCGTACTTTGAAGATGCAAAACAAAAACTTGCCTATGCCAAAGACACATTTCCTCCTGAGTTTCAATACTGTATTCCTATCAACAAGACAAGAAGTGGAATGCAGTTCACTTGTGCATCACCCTGCCAAGCACCTCACATGTTGGACAGAGGTAATCATTGTGGTTCAGGAGATGTCTGGGTTTGTAACAGTGATGGTTATGTGGGACAAGTGTGTATTCTCAGAATGGGATCTCAAATTCAGCCGTTCAGTTCCATTACAGTCTGCATGTCACGAATCCTCTGTATCTCTCCTGTGCCCGGCACCAAATTCAGCGGCTTGGAAGCACTCCAGTCTGAAAGCGAAACCAAATCCGACACTCATTCCATCTCACTGGGAAGCGAAAAGAGCAGCAAAACGAATACAAACCCCAAAATCTCACGCTCAGGTTACGCCAGCGACGAAGATGTCACTGGACCACAGAGCATCATGGCTTTCGACAGCAGCTCCGAAGACGAGGAGGGACTGGGTCAAGAGAGTTTTCTTGGCGGGAAATTCAACGACGGAAGCTCGCCGTTCGACGTCGACGGCCGCCTCAGTCCTGAAGGCAGCAGCCTGGGAACCACCGGAAGTGCTGACGGCATGGACAGCAGTCAAGACGAAAATGTGTTTGAATTCGAGGAAAATGACTCAAGCTGCGATGAGATGAAAGCTAAAGGATCCCGCAAGCATTCCGGCAAGCGTAGATCTCGCACCAGTAGGGAAGATCTCAAAGACAGCCTGTCGGATATTGTGAATTTTGATACTGATGAGGCATGTACAGTGTGGTTGGGTACAGAAGATGGATGTATTTTCGTATACCCGGCGAAGGAAGCCCAAAATAAGAAATCAAAGTTAAAGCTTCAGCATTCTGGATCAATTCAGTGCATTTTGTATGTTGATAATCAAGTCTTCATGTCACTATCAACTGGTCACTTGTATATTTACAGAAGACATCCAGGTTGCGCGTGGGAAGTAGGCAGTCCCGTGATGCTTCACATCGGAGAGTCGGCAGCAGTCTCCTGCATGACAGCTATTCACGGTCGGCTGTGGTGTGGCCTGGGTTGTAGTGCTGTCATTGTCAATACAACCACTTTAGCAGTCGAGACGTCGTTCAGCTGCAGCTTGGACAAGGACCGCGCTGTGTACCGCATGGCAAGCTCTGACATGGGTGTGTGGATTACGCTCCAAAGTTCATCCGTTGTGAGGCTTTTTCACGCCACGCGGTACGAGTGTCTGGCAGATGTTGACGTAGCACCTCCCGTACACAAAATGCTCCAAGGTTCTGATGCAATCATCCGCCAACACAAAGCAGCTTGTTTGCGTGTCACCGCTCTGCTCGCCTGCAAGGATCTCCTGTGGATTGGCACTAGCGCAGGCGTAGTGTTAACATTACCGCTGCCAACAATCACCGCCAGCACTGCTTCTCTGCGCAACTGCCCATCAGCCACAGCTTCGTTCCACGGGCATACGGGACATGTGCGTTTTCTCACTGCTGTCGAGGTTCCAAAAGAAGGAGCGCAAGACAGCACCAACGATAAAGGCTCCAGCACTACCATAAACACTTCTCCTACAACTACAACCGCGCCTCTTGCGCCGGGCACAACCGCTGGCCGGGACGTGTTGATTATTAGCGGCGGCGATGGTTATGAGGACTTCAGAGCAAGCTCCGCTAGCGAATCCGCTGGACGAGATGACAGCACAAATCATCTCCTTATTTGGCGTGTATGA

Transcript

OS493_011587-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96PE2	Rho guanine nucleotide exchange factor 17 OS=Homo sapiens OX=9606 GN=ARHGEF17 PE=1 SV=1
Q80U35	Rho guanine nucleotide exchange factor 17 OS=Mus musculus OX=10090 GN=Arhgef17 PE=1 SV=2
Q21653	Rho guanine nucleotide exchange factor osg-1 OS=Caenorhabditis elegans OX=6239 GN=osg-1 PE=2 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003382 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19057 all species →	PH_19	PH domain	Domain	Interproscan
PF19056 all species →	WD40_2	WD40 repeated domain	Repeat	Interproscan
PF00621 all species →	RhoGEF	RhoGEF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR000219 all species →	Domain	Dbl homology (DH) domain	Interproscan
IPR039919 all species →	Family	Rho guanine nucleotide exchange factor 10/17	Interproscan
IPR035899 all species →	Homologous_superfamily	Dbl homology (DH) domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12877 all species →	RHO GUANINE NUCLEOTIDE EXCHANGE FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_011587-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011587-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

75.0Max TPM

35.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	41.23	60.48
polyp at pH7 6	18	18	38.70	53.55
coral polyp · control treatment	16	16	32.49	54.69
coral polyp · oil and dispersant treatment	16	16	34.24	59.61
coral polyp · oil treatment	16	16	52.15	75.03
coral polyp · dispersant treatment	16	16	19.61	41.76
Polyp	10	10	22.59	35.98

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.48
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.39
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.36
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.95
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.43
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.36
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.42
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.07
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.14
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.17
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.25
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.10
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.05
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.83
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.93
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.50
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.55
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.88
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.68
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.03
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.19
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.84
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.92
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.78
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.38
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.07
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.29
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.32
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.68
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.84
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.55
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.69
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.34
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.06
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.10
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.98
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.33
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.80
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.49
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.18
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.08
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.26
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.05
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.56
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.84
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.61
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.27
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.19
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.28
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.17
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.18
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.12
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.14
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.20
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.45
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.95
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.64
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.27
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.64
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	75.03
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.56
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.64
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.27
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.30
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.37
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.18
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.67
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.24
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.22
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.85
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.76
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.82
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.27
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.85
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.65
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.53
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.42
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.31
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.67
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.73
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.80
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.95
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	35.98
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	35.60
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	29.88
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	27.99
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	19.64
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.85
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.16
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	14.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.25
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.71

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.