Gene detail

Detailed information of OS493_011615-T1 in Lophelia pertusa

Genomic Location: scaffold_29:3015322...3046463
NR annotation: KAJ7363327.1, Sister chromatid cohesion protein PDS5 A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011615-T1

ATGCCTCGCGGCGAGTCCGGTTCGTCTCCAAAGAAGAAGAGAGCGGCTGCCACAGACTTGCATGGAAAACTTAGCAAAGATGAGCTCATTAAACGGCTCAAGAGCCTAGCTGATGAACTCGCCAATGCTGACCAAGCTGATGGAGCAACAAAGTACGGCACTGTCGCGCAGTCTCTCGTCAGCCCATTCATCCTCAAACACAGGGACAAAGATGTCAAAATACATGCTGCATGCTGTCTTGCCGACATCCTTAGGATTTTTGCTCCTGACGCTCCCTACGATGAAGAACAATTAAAGGCTGTGTTTAGGATGATAACAAACCAGTTGAAAGGTCTTGAAGACACTAAATCAAACCTGTCCACAAAGTACTTTTATCTAATAGAGAGTTTAGCATTGGTTAAATCGTTCAATATTTGTCTGGATATGGACTTTCAAGACATTATTCTGCAGTTATTTAAACTGCTCTTCCAAATTGTGAATGAGAACCATTCCAACAAAATTCAGAATTACATGTTGGATGTGATGTGTCCAATCATTGAAGAAGGGGACTCTGTACCCCAGGAGGTGCTTGACACAGTGCTCGTCAACATCATCGAGCCACAGAAGAGCGAGGACCCTGTGGCTTATAAACTAGCAAGCGAGTTCATTAAGAGGACTTCAACTTCGTTAGAGCCTTACTTACAAATGTTTTTCAACAGTACTCTTGCACTGGGAAAGAAATCAGACAGTATTCTAGCAGATAACATTTACGACCTTATACTGGAGTTAAACAGAACTTGTCCAAGTACCCTTCTGTCAGTTGTGCCACAGTTGGAGTTTAAATTAAAGAGTATTGAGGTAGAAGAACGATTATCAGTTACCAAATTACTGGGCCAGATGTTTTCTGAACAGGATTCTGAACTAGCAACTCAACATAAACCTCTGTGGAACTCCTACTTAGGAAGATTTGTTGATATCAGTGTTGATGTTCGTTTGGAATGCATCAAAAGAACCAAAGAATTTCTACAGTTTCAGCCTGATCTGGTTGATGATTTAACTGATAAACTTCATGAGAGACAGCGTGACCCAGATGAGAGAGTGCGTCAAGAAGTAGTAAAGACAATCTGTGAAGCAGCAGCAGAAAATATCAATTGTATTTCTGATCAGCTTCTTGACGACTGGCATGTGAGGAGAGAGGCAATGATGTGTCTTGGGAAATTGTACAAGAAAATAACAACAGGTGCTACAGAAAACAAATCAGCAGCCAAGAAATTATCCTGGCTTCCAAGCAAGCTTCTTCACTGTTATTATCACAACACACCAGAAAACAGGCTTTGTGTGGAAAGGATTTTAATTGGGTGCTTGGTGCCAGTCAGTTTAGAAGCTGATCAGAAGATGAAAAGATTATTACATATTTATTGCAAACTTGATGATGCTGCAGTTAGTGCCTTGCATGGAATTTTGACATGCCAGCAAAGAGTGCGGTCAGACATTACAGATCTTATTGAGTTCTCAACTGGAAAGGAGTCACAAGATAATGAGACATTGGTTTTCTCAAAGATTATCTCTCTTGCAAGAGCCTTCCCAGATGCTTTTAAATTTCAAGAAAACCTCAAGAAATTACGAGAGATGATTCAGGAGCCCACGCTGAGAGAATTACTGAAGACATGCATCAACCCAGATGTTGGATGTTCAAATGTTTTCAAAGCAGTGAGTGATGTTGTATTAAAGGTTGGAGCCAAGAACCCCATCCTGGAGACACTCAAAGCTCTTCTGGATCGTGCTGCACCTCTTCTTGTAGATGAACACTCTGGGATGAGTCCTGTCGGAAAGAAGGGCTTGGCACTGCTGTTGAGTCTGGCTGGCGTGTGTCCTTCTCAATTTCAAAACGATGACACATTTCAACAGCTACTGGTCTTTCTGAAAAATAAGGATCAAGAGATAGTTGATCTGTCACTAAAGATGCTTGCCTTGACTGGGGATGGCATTGAGAAAGTCAACAAATCATTAGCTAATTACTATCACCCAGTCTTGTCCAAGCTTGCATTAAAGGGAACTCCATGTCAAGCCAAGCACTCTCTGAGGTCCATTGCAAAGATTTCTGCTGCTTCTTCGCAACCTTTTGATCGTGTCTTTTCAAACCTTGTGAGCTCCTTAAGATATGAATGCCCTCTTCTGCTAACATCGCTAACAGCTCTTGGGGAGATTGCGGTTTTGGCACCTGCCCTGTTTGAGACTGAAAGGCCTGCCATTGTGCGAGATTTTGTAGTAAAGGAACTGCTGGTGAAAGACAGGGGTGAAGCTGCTGATTCTGATGAAAGTGAGAGTGCGTGGTGTGAAGACAGAAATGTTACCCAAGAAACACAAGCAAAGATCAAAGGTATACATCTTCTAGTGAAGTGGCTGAGGGGCCGGGAAGGTAATCAAAAGTCTTCTGCTCAACCAGTGCTTAGAATGCTGGACACTATGCTCTTACATAAAGGGGATCTACAAAATCAGGGATGCGTCAGCGCTGCTGATTGTTCAAGACTTCGTCTTGCTGCAGCCTGTGGAATCATTAAGATCGCTCAGGAACTTCACTATATTGATTGTATAACTCTGGAGAACTTTCAGCAGATTTCATTGGTTATGCAGGACTCTTGTTATGAGGTTCGAGACAAGTTTACCAAGAAGCTTCACAAAGCGGAAGATTTACTGAAACTTCCCTTGGAGTATCTCGGGATATTTGCACTGGCAGCACCAGAACCTGACAAGGAAAGGAGAAACCAGGTTAGACAAATGATTGCAAAGAATGTCAAGACAAGACGGGACTATGTAAAGCAACACTCAACAGCTCAGGCTTGTTCACACTCCATTCTGCCAGAGTATGCTCTGCCCTGTGTTATCCACATGCTGGCTCATCATCCAGACTTCAAACAAGACGATCATGAGACTCTTGTACAATTCCGAGATTATCTTTGGTTCTTTATGGAGCCGATTTTGGCCAAAGCAGATAATTACAGCTTCTTGAAAAAACTGGTAGAAAACGTCAAACAAACCAAAGATGCCCAGGCACCTGATGATGACGAAATAAACAAGAACCTTTACACCGTTTGTGATCTGGCACTGGGACTCCTCTTAAACAAGGTCCACTCATTCGTTTTGAAAGAATTCCCTGGCAACCCTGTTCTACCAAAGAGGTTCTTTGTTCCATCGGAGGGAGGTAGTCCCAACACTAAAAGTTATCTACCAAAAGGATTCCAGTTCATTGCTGCAAAGGGACAGAAGAAGGGAGGAACAGTGGAATCAAAGACAACTCCTTCAAAGACATCATCAAAAACCTCTGCCAAAAGTGATAAGAAAAAACAAGGGAAATCTCCAAAAAGCAAAACTGCGAAGACTTCCAAGAATACTTTCAAGGAGAAAGTCAAAGAGATTCAGTTAGAACTGGAGGAATCGTCACCAGAGACTCCAGAGAGCGGCTTCGCTAGTCCCGCTGATGAGCAACCATCTCCAAGGAAAAGAGGGAGACCGGCTAACTCATCCGAGAAAACGTCGGCAAAGAAATCAAGAAAAGAATCTCCTGACAAGAACGCGAAGTCAGACAAGAAAACATCAGCCAAAGAACTGAACTCGTCAAATAAACGCAAAGAATCTAAACAAAAAAAGTCGTCATCTCCATCACCGCCTAAAAGTCCACAGCGGCGCTCGCCATTCGTATCAGCGGAAAAGTTGTCTTCGGCTGCCAAGCCTTCACCAAGGAAAGCGCGAGCAACAAAGAGACTGGCTTCTGAGTTAGACACTTTACCAGAAGATGAACCCACGCCGGACAGCGGTACCTCCAGTTTGGACTCGCCCAAGAATCCACTCAGTACAAGACAAATATCACACCAGAGTCCTAAAACGAAATCAAGAAACGAAGTCAATGGGATAGCAGATAAAAGTCCAAGTAAACTAAAAAGAAAGAAGGACGCTGAGGAATCAAAACCTAGTCCGGTAAAAAAGAGCAAAGTATCACATTCGTCACCAACGAAACGGAAAGAGCCCCCATTAGTTGTGAAAAGGAAAATTAGCAAGAGAAGATAA

Transcript

OS493_011615-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5F3U9	Sister chromatid cohesion protein PDS5 homolog B OS=Gallus gallus OX=9031 GN=PDS5B PE=2 SV=3
Q4VA53	Sister chromatid cohesion protein PDS5 homolog B OS=Mus musculus OX=10090 GN=Pds5b PE=1 SV=1
Q9NTI5	Sister chromatid cohesion protein PDS5 homolog B OS=Homo sapiens OX=9606 GN=PDS5B PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003756 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20168 all species →	PDS5	Sister chromatid cohesion protein PDS5 protein	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR039776 all species →	Family	Sister chromatid cohesion protein Pds5	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12663 all species →	ANDROGEN INDUCED INHIBITOR OF PROLIFERATION AS3 / PDS5-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000785 all species →	Cellular Component	chromatin	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0007064 all species →	Biological Process	mitotic sister chromatid cohesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11267	PDS5; sister chromatid cohesion protein PDS5	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011615-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

30.5Max TPM

5.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.05	6.70
polyp at pH7 6	18	18	3.68	4.78
coral polyp · control treatment	16	16	7.79	30.54
coral polyp · oil and dispersant treatment	16	16	5.49	26.64
coral polyp · oil treatment	16	16	6.15	11.72
coral polyp · dispersant treatment	16	16	5.36	14.26
Polyp	10	10	3.54	7.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.70
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.94
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.31
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.92
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.66
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.68
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.54
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.90
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.55
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.84
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.57
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.33
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.29
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.22
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.06
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.23
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.87
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.68
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.43
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.54
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.11
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.34
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.43
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.26
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.53
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.47
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.38
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.30
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.29
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.66
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.64
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.68
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.03
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.81
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.14
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.38
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.83
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.28
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.93
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.82
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.91
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.60
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.72
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.71
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.68
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.96
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.04
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.70
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.97
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.93
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.71
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.48
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.33
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.78
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.48
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.26
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.49
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.79
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.33
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.27
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.18
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.04
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.30
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.08
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.88
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.44
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.09
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.96
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.27
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.15
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.57
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.83
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.10
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.69
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.55
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.28
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.61
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.36
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.89
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.53

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.