Gene detail

Detailed information of OS493_011718-T1 in Lophelia pertusa

Genomic Location: scaffold_30:509035...544563
NR annotation: KAJ7336512.1, hypothetical protein OS493_011718 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_011718-T1

ATGGAAGGTGCAGGGGAAGCCCCACCCCCTCCTCCCCCACAAGCACCTACACCAGAACCAACACCAGCTCCAGCACCAACCCCACCGCCTCCTGCGCCAGAGGCAACACCACAGCCTGCTGAGAGACCAGTCACTCCAGAGCCTGAAAAAAAAACTTCGTCATCATCTAAATCCAAAGATGAGATCCCAGAAAGTGCAGAGCCATCAGCTGGTGGGATTACTGAAAAAACACAGGAAAAACCTTCTGGCACTGGAGATTTTGTAGCAAAAAGTGAAGCCAGGAAGAAGCTACCTGATAAAAATCTTGATTTCCAGGTCAGAGTGAGGATTGTTGAGGGCCGTCAGTTGGCAGGTGCTAATATCAGCCCTGTGGTCCGTGTGACTATTGACAACCAGACACGGCAAACTAAGGTTGTCAAGTCAACCAACAAACCATTTTATGATGAGGTGTTTTTCTTCAACTTTAACATGACACCACACAAGCTGTTTGATGCTCAGGCTATATTTGAGGTATTTAATTCCAAGAAATTAAGATCAAATGCAATGGTGGGGAGTTTTCAGTGTGATGTTGGATTCTTCTATGATGAGCCTTCCCATGCTGTTATAAGGAAGTGGATTCTGTTATCTGATCCAGAAGATAAAATGGCAGGAGCAAAGGGTTACTTGAAAGTGACAGTGATGGTTCTTGGACCCGGGGATGAGGCTCCAGTAGTGTCTGTAAGTGAAGATCAAGATGATCTTGATGACATTGAAGACAACTTGATCCAGCCTCCAGGAATGATGCTTAGACCAGCAGTTTTCTCCTTGCGAATATTCAGAGCTGAAGATATTCCACAGATGGACTCTGCTATTGCTGAGTCACTTAAAAGAAGCCTAGTTGGTGGTGCGATGAAAGAGTTGGTTGATCCATATTTGGTGTTTTCATTTGCTGGTAAAGAGGGAAAAACAGACATCCACAAAAACTGTGACCATCCTGAATTCAATCAAGAGCTACATGTTCCATTTCAGTTCCCTACAATGGCTGAAAAGTTGAAGCTGCAGTTATGGGACTGGGATAAAATAAGTGGCGATGATTGTATTGGCACCTATTATCTTCCAATGTCTGAGATATCAGGACAAGGAGAAGAAGGTTATCTGCCAAGGTTTGGACCATGCTTCGTCAACTTTTATGGCTCCACTAGAGAATACTCTGACCTTCCTGATACATACGAAGATCTCAATGTTGGCATTGGTGAGGGTGTTGCATACCGTGGTCGAGTACTGATTGAACTTGAGACAAAGCTTGACACTCAACCAACAAAGCTGGTAGAACAAGTCCTCAGTGATGACATCATACGCGTCCAGACTTACCTCCGTCGGCGTAAATACAAGTTGTTTACTTGTTTCCTGGAAGCCACCATGGTTGCTTGCACTGATGGGCCTGTTACTTTTGAAATAAGCATAGGTAACTATGGAAATCAGCTTGATTTGTCAGTCCCACCCTCGTCATCTTCTACCTCACCAACAAATGCCATATTTGATGGCAGCTCTTATTACTTTCTGCCATGGAATGATATTAAACCGTGCTGTAATGTCGACAGCCACTGGGAGGATATCGCCTTCAGACTGGAGCCACTAAACATCCTCACACGAATGTGTGAACAACTTGAAATTGACTTGGAAAAGGTCCAGCTTGCGGTCTCTGAAAATGCACCACTAACCACTGTTGCAGTTCTTATCATGCAAGTGCTGGACACAATAATAGAGAGTTGTAGCAAACCGCTTCCTCAGAAGACAGCTAGAACACCCGGAGTTAACGATCTTGACCTCAAAATAAGGGAGACAAGAGAATGTGAGCTGAAAGCTATCCTAGAGGAGGCCTCAAAACTGCGTACAAGTGCAACAGACGTGGACGAAACGATTGGTGTCATGGAGGACTTTATAAAGAGGCTGCGATTTCTTGCAATTGAGCCTCAGAACAGTATGCCAGATGTTGTTATCTGGATGATGAGTGGGGAGAAAAGGATAGCGTATCACCGAATCCCAGCTTATGATCTCTTGTATTCACCACACGTGGATGCTCGAGGGAAGCATTGCGGAAAAACAATGGATCTGTTTATGCAGTACCCTGGAAAGAAACAGTTTAACTTAGAGGATTACCCAGAAGTCCCCGCTCAAGTTCGCGTGATGCTGTGGCTTGGGCTCGAGAAACATCAAGAGGCTTGGTCCAACCGCCAGGAGACTGAGGGCGACTTTTGTGTATTTGCAGAAACGTACGAGAATATGATGAGTGTTCTTGGCAAGTGGACTGCTAAAGGACTCCCTCGTCCAGCCTGGTCAAATGCTGGTGGATCGTTAAAGCTTCTGAAAGATTCCTTTATTCCACCGGATGGGTGGAGTTTTGATGGAAAGTGGTTCATTAATCCAGAGTTAAGCTTAGCTTATGAGAAAGATACAGGTTGCAAGAATTTTCTGGAGGACTTGTTTGAAAATGAAGATCGCATTCCTGGAGGACACTGGAACCCAGCCTCGGTGAACTGGACGGACATCCACGGGAATGGTACTACCAGTAAGGACTCGTTAGTGGCTCCTGAAGGCTGGGATTGGACGTCAGAGTGGAACGTGGACACCAATAGGGCAGTGGATGAAGATGGGTGGGAATACACAGTGGACACAAGTGTGGCTAGTTATGTGGCGGTAGAGAAAACGTATCATATGTGCAGAAGGAGAAGGTGGGTGCGCAGCAGAAACCTGGTGAAGAGCACAGAGAAAGAAGACAAGGATAAAGTTGACACGGACGGATGGGAATACGCTACAGTGTTTTCATCAAAGTTTCATAGCAAAAGCCGCACACGAGATTTAGTTCGACGTCGAAGATGGCATCGAAAAATGGTACAAACAGATCCTACCGCGCCTGCAGTGTTCCAGATATCTGAAGAGGGTAAAAAAGGAGGAATTATGATGGTGCCGCGGATGTTCATCACATTTGAAAATGCCCACAAGTATCAGCTGAGAGTGTACCTGTTCCAGGGACGAGATCTGCTGCCTTCTGATCCTGATGGACTGTCTGACCCCTATGTGCGCATTTCATTTGGCACTCAGAGCCAGGTATCAGAGATCATTCACCGCACTCTATGTCCCACCTGGGACCAGACGCTTATCTTTGAAAATGTCTACATTTACGGCAGTCCTGAAATCACCGAGAAGTCGCCACCTCATGTTGTTATGGAACTGTTTGATCAAGATGCTGTGGGTAAAGATGAGTTCATGGGTCGCTGTGTGGAATCTCCTGTTGTGAAACTACAAGGCCAGGGTCCCCCAGCCCCGAGACTGTTATGGGAACCAGTGATGAAGGGAACAGAAGATGGCGGAGAGATTCTGGTCGCGTTCGAGCTTTTCCTGGACGAAGGAAACGATTTGCCTTACTACCCTCCTACTAAAGAACACAAGCCATCCTTGTACATCGTACCCAGTGGAATCAGACCCGCAATGCAGCGCACAGCTATTGAGGTGCTGTGTTGGGGTGTTAGAAACATGAAGAAGTTTCAACTGGCCAATGTCTCCTCTCCTGGCATCGAGTTCGAGTGCGGTGGTCACATGATTCAATCGTCGGTCATCAAGAACACGCAGAAAAATCCCAACTTTGATCAACCAATCTTCTTTTTTGACACTTATCTTCCGAAAGAAGAGCTCTACACTCCACCAATGAACATCAAAGTGCGAGATAACCGTTCGTTTGGCCGTCGACCCGTTGTCGGTGTTCATTGCATCAAGTCACTGCAGCCCTACAGGTGTTTACCGCTGGACCACTCTGGTATTGGTGAAGACGAAGCTGATGCAGGCAAAGAAGAAGATTCTGGATCTTATTTGATCGACATTACTGATGAGAAAGATAAAACGGAGTTAGTAGAGGAGGACATAGACTGGTGGTCAAAATTCTACGCCTCCGTGGATGACTTTGAAAAATGCGGCGACTACATAGAACGTGGCTACGACAAGATCACGGTGTACGATCAAGAGCTGGAAAACATAGAGATCTATCAAAAGTTTCAAGATTTAGTAAAGACATTTGATCTTCATCGTGGAAAGGTGAAACCTGGAGAGGATGCAGCAGTTGTAGGCGAATTTAAGGGATCGTTCCATGTGTACCCGCTGCCTAGTGATCCTAACATTCCTCTTCCTCCTCGCATTCTGAAAACCTACCCCCCAGTGAACCGGTGGAGTGTCTTGTTAGAGTTTACATCATCAAGGTGGGTCCTTAAAACGCGATCGTGA

Transcript

OS493_011718-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9NZM1	Myoferlin OS=Homo sapiens OX=9606 GN=MYOF PE=1 SV=1
B3DLH6	Myoferlin OS=Xenopus tropicalis OX=8364 GN=myof PE=2 SV=1
Q69ZN7	Myoferlin OS=Mus musculus OX=10090 GN=Myof PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000314 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08165 all species →	FerA	FerA (NUC095) domain	Domain	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF08150 all species →	FerB	FerB (NUC096) domain	Domain	Interproscan
PF08151 all species →	FerI	FerI (NUC094) domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012561 all species →	Domain	Ferlin B-domain	Interproscan
IPR012560 all species →	Domain	Ferlin A-domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR006614 all species →	Domain	Peroxin/Ferlin domain	Interproscan
IPR037720 all species →	Domain	Ferlin, second C2 domain	Interproscan
IPR037721 all species →	Family	Ferlin family	Interproscan
IPR012968 all species →	Domain	FerIin domain	Interproscan
IPR037723 all species →	Domain	Ferlin, fourth C2 domain	Interproscan
IPR037722 all species →	Domain	Ferlin, third C2 domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12546 all species →	FER-1-LIKE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0007009 all species →	Biological Process	plasma membrane organization	Interproscan
GO:0061025 all species →	Biological Process	membrane fusion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18261	DYSF; dysferlin	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_011718-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

43.6Max TPM

5.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.06	43.60
polyp at pH7 6	18	16	8.13	24.30
coral polyp · control treatment	16	16	5.17	14.64
coral polyp · oil and dispersant treatment	16	16	4.81	13.98
coral polyp · oil treatment	16	16	4.67	15.16
coral polyp · dispersant treatment	16	16	5.27	12.50
Polyp	10	8	2.32	6.88

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.60
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.56
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.65
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.61
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.07
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.73
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.81
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.71
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.68
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.55
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.43
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.37
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.36
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.30
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.55
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.60
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.33
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.35
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.07
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.15
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.79
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.52
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.51
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.51
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.23
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.91
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.05
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.91
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.68
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.71
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.23
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.18
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.13
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.79
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.46
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.45
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.98
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.96
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.08
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.81
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.69
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.36
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.68
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.16
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.30
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.81
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.47
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.41
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.89
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.83
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.40
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.06
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.71
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.15
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.27
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.50
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.46
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.74
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.73
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.61
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.84
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.52
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.58
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.76
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.88
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.93
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.84
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.22
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.91
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.